DOC

Ginkgo Biloba Extract (GBE) Enhances Glucose Tolerance

By Tom Cox,2014-10-20 13:31
10 views 0
Ginkgo Biloba Extract (GBE) Enhances Glucose Tolerance

     http:///week114

    Ginkgo Biloba Extract (GBE) Enhances Glucose Tolerance

    in Hyperinsulinism-induced Hepatic Cells

    Zaiqing Yang, Tao Xia, Li Gan, Xiaodong Chen, Lei Zhou

    College of Life Science and Technology, Huazhong Agricultural University, Wuhan city, Hubei

    province, 430070, P.R.China yangzq@mail.hzau.edu.cn

    Abstract

    Ginkgo biloba, an herbal medication, is capable of dropping glucose, fat and lipid peroxide and preventing atherosclerosis and complications in diabetic patients. In our studies, we tested the hypothesis that ginkgo biloba extract (GBE) prevents glucose intolerance induced by hyperinsulinism in hepatocytes. We investigated the effects of GBE on glucose ingestion, glucokinase activity and mRNA levels of key genes in glucose metabolism and insulin signaling pathway. To better show its efficacy, we included a control group that was treated with rosiglitazone, a kind of thiazolidinediones (TZDs). The data showed that GBE repressed glucose ingestion in normal status, whereas it dramatically improved glucose tolerance in insulin resistance status. Moreover, by analyzing gene expression, we suggested that GBE chiefly exerted its effects by stimulating IRS-2 transcription. It should be noted that, not like rosiglitazone, GBE didn’t stimulate overmuch glucose uptake in

    improving glucose tolerance. It is said that GBE treatment could avoid drug-induced obesity. The data suggested that GBE had potential efficacy to prevent insulin resistance induced by hyperinsulinism. Keywords: antidiabetic drugs, diabetes prevention, insulin resistance, liver, rosiglitazone

    Glucose-6-P, glucose-6-phosphate; GK, glucokinase; G-6-Pase, Abbreviations:

    glucose-6-phosphatase; IRS, insulin receptor substrate; GLUT, glucose transporter; PPAR, peroxisome proliferator-activated receptor; SREBP, sterol regulatory element-binding protein. 1 INTRODUCTION

    Ginkgo biloba, an herb, has been used as traditional Chinese medicine for thousands of years. Ginkgo biloba extract (GBE) is being widely studied and applied for its beneficial properties in treatment or prevention of human diseases. Ginkgo biloba trees mainly distribute in China, France, and

    USA, producing a mass of dried leaves each year to meet the commercial demand of market [1]. GBE has been reported to drop glucose, fat and lipid peroxide and prevent atherosclerosis in animal model and human. To our knowledge, no systematic study illustrates the molecular mechanism of its efficacy on improving insulin sensitivity and enhancing glucose tolerance in insulin resistance model.

    In previous studies, GBE was found to have anti-inflammatory [2] and stimulate skin microcirculation [3]. And it was used as a therapeutic agent for some cardiovascular and neurological disorders. People also found it could attenuate the negative effects of some drugs [4, 5]. Recently, accumulating in vitro and in vivo evidence demonstrated that it had potential efficacy in lipid metabolism, glucose metabolism and diabetes mellitus. Saponara showed that GBE inhibited cAMP phosphodiesterase in rat adipose tissue [6]. Mario illustrated that the biflavones of ginkgo biloba

    stimulated lipolysis in fully differentiated 3T3-L1 adipocytes [7]. Boveris obtained the same results as Mario and further showed GBE inhibited lipid peroxidation [8]. By investigating diabetic rodent model, Nian hong et al. indicated that GBE dropped the after-dinner blood-glucose, decreased the contents of

     This work was supported by the High Education Doctorial Subject Research Program (No: 20010504003), the grants from the General Program (No: 30170674) and Key Program of National Natural Science Foundation (No: 30330440) and 863 Program (No: 2004AA222170) of China to Dr. Z.Q. Yang.

     http:///week114

    TC, TG and LDL, promoted SOD activity and relieved the damage of pancreatic islet [9]. Moreover, Li et al. found GBE could prevent and treat atherosclerosis by decreasing serum lipids levels, suppressing inflammatory response and protecting endothelial cells [10]. As we know, oxidation-modified LDL plays an important role in the pathogenesis of artherosclerosis with type II diabetes melllitus. GBE was also capable of inhibiting the oxidation of LDL [11, 12]. In addition, early detection of pathologic function of the retina plays very crucial role in monitoring of visual complications in diabetic patients. Researchers showed GBE prevented diabetic retinopathy and they thought it was a good adjuvant to patient with long lasting diabetes mellitus [13]. All data suggested that GBE was of value in diabetic therapy.

    Liver is an important organ for glucose metabolism and energy homeostasis. And hepatic insulin resistance is an important component in the development of type II diabetes mellitus. In this process, PPARs, GLUT, G6Pase, IRS and SREBPs play crucial roles. GLUT2 is the primary

    glucose-transporter isoform in liver and plays a key role in glucose homeostasis by mediating bidirectional transport of glucose [14]. PPARs and SREBPs are characterized well transcription factors. PPAR was deemed the main isoform in adipocytes before, but now people found it might also mediate lipid metabolism and energy homeostasis by changing its expression in liver [15]. SREBP1c is crucial for the regulation of lipogenic gene. And recent studies also found that it was interrelated with insulin action [16]. G6Pase as the last enzyme in hepatic glucogenesis, is an important determinant of hepatic glucose fluxes. Moreover, IRS-2 was main isoform in liver. It compensated for the lack of IRS-1 in IRS-1-/- model [17]. So hepatic insulin signaling was mediated mainly through IRS-2, rather than IRS-1 [18].

    In this study, we tested the hypothesis that GBE involves in modulation of insulin action and enhances glucose tolerance. To better interpret its molecular mechanism, we assayed above gene expressions and glucokinase activity.

2 MATERIALS and METHODS

    2.1 Materials.

    The powder form of GBE was purchased from Greensky Biological Tech Co., Ltd. (Hangzhou, China). The GBE contained 24 flavonoids, 6 terpenes and less than 1 ppm of ginkgolic acid. The

    composition of the flavonoids and terpenes in GBE was similar to that of EGb 761 used in European countries. TRIzol was obtained from Sangon Co., Ltd. (Shanghai, China). Mammalian Cell Protein Extraction kit was purchased from Shenergy Biocolor BioScience & Technology Co., Ltd. (Shanghai, China). Glucose Assay Kit was obtained from Shenergy-diasys Diagnostic Technology Co., Ltd. (Shanghai, China).

    2.2 Cell culture and treatment.

    L-02 cell line was derived from normal adult liver [19]. They were grown in DMEM supplemented with 10% fetal bovine serum at 5% CO2 and 37?C. For the relevant experiments, the density of cells

    was about 5105 cells/well in 24-well culture plates for RNA extraction or 5;, 106 cells/dish in 60-mm

    Petri dishes for metabolite concentration assay. There were two group cells in experiments, namely A and B. A mimicked normal physiological status and included NC, NRT and NGT. All cells were treated with 10nM insulin. NC stood for Normal Control (NC); NRT was given 10M rosiglitazone

    that was a kind of TZDs and stood for Normal Rosiglitazone Treatment (NRT); NGT was given 10mg/l GBE and stood for Normal GBE Treatment (NGT). B mimicked insulin resistance status by hyperinsulinaemic and hyperglycaemic treatment in vitro [20, 21]. There were three kinds of B,

    2

     http:///week114 designated AC, ART, AGT. AC, ART and AGT were given 100nM insulin and AC stood for Abnormal Control (AC). ART was given 10M rosiglitazone and stood for Abnormal Rosiglitazone Treatment (ART). AGT was given GBE and stood for Abnormal GBE Treatment (AGT). All treatments are listed in table 1.

    Table 1. The description of cell treatment.;, indicates that groups include relevant agents.

     Group A B

    Agent NC NRT NGT AC ART AGT

     ,;,;,;Insulin(10nM)

    Insulin(100nM) ,;,;,;

    Rosiglitazone ,;,;

    GBE ,;,;

2.3 RNA isolation.

    Total RNAs were isolated from L-02 cells using TRIzol after culturing the cells for 36h. All of the RNA samples were treated with Dnase I to digest the genomic DNA and stored at -80?C. 2.4 Semi-quantitative RT-PCR.

    Semi-quantitative RT-PCR with glyseraldehyde- 3-phosphate dehydrogenase (GAPDH) as an internal control was performed to determine the levels of PPAR, IRS-2, GLUT2, SREBP1c and G6Pase

    mRNA in L-02 cells. A 4μl RNA sample was reverse transcribed with oligo(dT)18. cDNA (2μl) was

    used for PCR amplification with 1U Taq DNA polymerase. The PCR products were run on a 1% agarose gel containing ethidium bromide and viewed under UV light. All primers are listed in table 2. Preliminary experiments were carried out with various amounts of PCR cycles to determine the linear range of amplification for all of the studied genes. The results for the expression of studied gene mRNAs are always presented relative to the expression of GAPDH.

    Table 2. The primers use for semi-quantitative RT-PCR.

     Forward and Reverse primer (5-3) Gene name Size (bp) accession number PPAR;;195 F: TCTCCAGTGATATCGACCAGC BT007281

    R: TTTTATCTTCTCCCATCATTAAGG

    IRS-2 383 F: CACCTCCCCACGACAGTTGC NM_003749

    R: GGTGGGACAAGAAGTCAATGCTG

    GLUT2 398 F: TTTTCAGACGGCTGGTATCAGC J03810

    R: CACAGAAGTCCGCAATGTACTGG

    SREBP1c 248 F: CACCGTTTCTTCGTGGATGG BC057388

    R: CCCGCAGCATCAGAACAGC

    G6Pase 244 F: CGACCTACAGATTTCGGTGCTTG NM_000151

    R: AGATAAAATCCGATGGCGAAGC

    GAPDH 452 F: ACCACAGTCCATGCCATCAC BC083511

    R: TCCACCACCCTGTTGCTGTA

    3

     http:///week114 2.5 Protein isolation and concentration assay.

    Proteins were isolated using the Mammalian Cell Protein Extraction kit. Protein concentrations were determined by Bradford assay [22].

    2.6 Glucose concentration assay.

    The glucose concentration in medium was assayed using the Glucose Assay Kit. Absorbance was assayed at 340nm using BECKMAN COULTER DU 800 UV/Visible spectrophotometer. All sample concentrations were normalized by each protein amount.

    2.7 Glucokinase assay.

    Enzymatic activity was assayed as described previously [23], using NAD as coenzyme and Glucose-6-phosphate dehydrogenase as coupling enzyme. The assay buffer contained 100mM triethanolamine hydrochloride (Tris-HCL, pH 7.8), 5mM MgCl2, 5mM ATP, 150mM KCl, 2mM

    dithiothreitol, 0.2% bovine serum albumin, 1mM NAD, and 1unit/ml of G6PDH. Correction for low hexokinase activity was applied by subtracting the activity measured at 0.5mM glucose from the activity measured at 100mM glucose. Absorbance was measured at 340nm using BECKMAN COULTER DU 800 UV/Visible spectrophotometer. Enzymatic activity was expressed in milliunits per mg of protein.

    2.8 Statistical analysis.

    Results are expressed as means;( S.E. of 3 experiments. The comparison of different groups was

    carried out using Student’s t test. The significance level chosen was P;, 0.05.

3 RESULTS

    3.1 In normal status, GBE suppressed glucose ingestion and glucokinase activity. All cells were cultured in DMEM. NC was treated with 10nM insulin; NRT was treated with 10nM insulin and rosiglitazone; NGT was treated with 10nM insulin and GBE (as described in Materials and Methods). The glucose uptake and glucokinase activity were determined at 0h, 18h and 36h, respectively. The data indicated that GBE inhibited glucose uptake (36% reduction, p<0.05, 18h; 9% reduction, 36h) (Fig. 1A) and glucokinase activity (no effect, 18h; 5% reduction, 36h) (Fig. 1B) compared with control (NC). The trend was impaired with time. The decline of GBE concentration was a possible explanation for this phenomenon. Contrary to GBE, rosiglitazone stimulated glucose uptake (20% induction, 18h; 44% induction, p<0.01, 36h) (Fig. 1A) and glucokinase activity (1.8-fold induction, p<0.01, 18h; 27% induction, p<0.05, 36h) (Fig. 1B) compared with control (NC). The results suggested that in normal status, GBE decreased the risk of obesity by suppressing overmuch glucose ingestion.

    4

     http:///week114

     Fig. 1 In normal status, the effects of GBE and rosiglitazone on glucose ingestion and glucokinase activity. After plating, L-02 cells were cultured for 36h as described in Materials and Methods. After 0, 18, and 36h glucose ingestion (A) and GK activity (B) were determined. Results are the mean;( S.E.

    from values obtained from three independent cultures. A,;; (p;, 0.05),;;; (p;, 0.01) indicates that

    glucose ingestion was greater or lower in treatment cells than in control cells (NC). B,;; (p;, 0.05),;;;;

    (p;, 0.01) indicates that GK activity was greater or lower in treatment cells than in control cells (NC).

3.2 In normal status, GBE increased mRNA levels of PPAR, IRS-2 and G6Pase.

    To further understand the mechanism that GBE regulated glucose ingestion, the mRNA levels of PPAR, G6Pase, GLUT2, SREBP1c and IRS-2 genes were measured. All cells were treated as described in Materials and Methods. After 36h, cell RNAs were isolated. The results from semi-quantitative RT-PCR (Fig. 2A) demonstrated that GBE stimulated expressions of PPAR (30%

    induction; p<0.05), IRS-2 (69% induction; p<0.05) and G6Pase (1.2-fold induction; p<0.01) observably (Fig. 2B). PPAR involved in insulin signaling pathway and could regulate insulin

    sensitivity. The increase of its expression would make cells be sensitive to insulin. IRS-2 was a crucial molecular in intracellular insulin signal transduction. It was able to elevate intracellular insulin sensitivity by enhancing its expression. The increases of PPAR and IRS-2 indicated that GBE was

    able to enhance insulin sensitivity. As a result, cells would increase glucose ingestion. G6Pase as a key enzyme catalyzed the last step reaction in hepatic glucose synthesis. Its increase might lead to augment glucose output in liver. It was interesting, that GBE might enhance glucose ingestion and output at one time. The data suggested that GBE quickened cellular metabolic rate. Different to GBE, rosiglitazone increased all genes expressions (Fig. 2B). It meant that they acted on different signal pathway.

     5

     http:///week114

    Fig. 2 In normal status, the effects of GBE and rosiglitazone on gene expression. After plating, hepatocytes were cultured for 36h as described in Materials and Methods. After 36h, total RNA was extracted and analyzed for the expressions of PPAR, IRS-2, GLUT2, SREBP1c and G6Pase (A). The

    quantification of blots for these gene expressions, obtained in 3 independent cultures is shown (B). GAPDH was used as an internal control to normalize the expression levels of these genes.;; (p;, 0.05),

    ;; (p;, 0.01) indicates that expression level of gene was greater or lower in treatment cells than in control cells (NC).

    3.3 In insulin resistance status, GBE improved glucose ingestion and glucokinase activity. All cells were cultured in DMEM. NC was treated with 10nM insulin; AC was treated with 100nM insulin; ART was treated with 100nM insulin and rosiglitazone; AGT was treated with 100nM insulin and GBE (as described in Materials and Methods). The glucose uptake and glucokinase activity were determined at 0h, 18h and 36h, respectively. The results showed that 100nM insulin inhibited glucose uptake absolutely (Fig. 3A). The data indicated that GBE stimulated glucose ingestion dramatically (Fig. 3A). It suggested that GBE had potential efficacy in preventing insulin resistance. In addition, GBE enhanced glucokinase activity, but it was not significance. It meant glucokinase did not play a key role in GBE treatment. Rosiglitazone had the similar efficacy with GBE’s. It stimulated markedly

    glucose uptake (Fig. 3A) and glucokinase activity (Fig. 3B), too. But in this process, rosiglitazone made cells ingest overmuch glucose.

    Fig. 3 In insulin resistance status, the effects of GBE and rosiglitazone on glucose ingestion and glucokinase activity. After plating, L-02 cells were cultured for 36h as described in Materials and Methods. After 0, 18, and 36h glucose ingestion (A) and GK activity (B) were determined. Results are the mean;( S.E. from values obtained from three independent cultures. A,;; (p;, 0.05),;;; (p;, 0.01)

    indicates that glucose ingestion was greater or lower in treatment cells than in control cells (NC);;? (p;,;

    0.05),;?? (p;, 0.01) indicates that glucose ingestion was greater or lower in treatment cells than in control cells (AC). B,;; (p;, 0.05),;;; (p;, 0.01) indicates that GK activity was greater or lower in

    treatment cells than in control cells (NC);;? (p;, 0.05),;?? (p;, 0.01) indicates that GK activity was

    greater or lower in treatment cells than in control cells (AC).

    3.4 In insulin resistance status, GBE increased expressions of IRS-2 and GLUT2 and decreased SREBP1c expressions.

     6

     http:///week114

     To further understand the mechanism that GBE improved glucose tolerance, the mRNA levels of PPAR, G6Pase, GLUT2, SREBP1c and IRS-2 genes were measured. All cells were treated as described in Materials and Methods. After 36h, cell RNAs were isolated. The results from semi-quantitative RT-PCR (Fig. 4A) demonstrated that GBE enhanced expressions of IRS-2 (1.5-fold induction; p<0.01) and GLUT2 (0.9-fold induction; p<0.01) and inhibited SREBP1c expression (27% reduction; p<0.05) in hyperinsulinaemic hepatocytes (Fig. 4B). As in normal status, GBE also stimulated IRS-2 expression. It was very important to improve insulin sensitivity. GLUT2 as a main glucose transporter in liver, the increase of its expression was helpful to cell for taking glucose. SREBP1c is crucial transcriptional factor to regulate lipid metabolism. On the one hand, the decrease of its expression would reduce lipid production; on the other hand, considering SREBP directly suppressed IRS-2 expression in transcriptional level, its decline might be a reason for augment of IRS-2 expression. Rosiglitazone had similar effect with GBE on genes expression. Different from GBE, PPAR had a higher expression level and IRS-2 had a lower expression level in rosiglitazone treatment.

    Fig. 4 In insulin resistance status, the effects of GBE and rosiglitazone on gene expression. After plating, hepatocytes were cultured for 36h as described in Materials and Methods. After 36h, total RNA was extracted and analyzed for the expressions of PPAR, IRS-2, GLUT2, SREBP1c and G6Pase (A).

    The quantification of blots for these gene expressions, obtained in 3 independent cultures is shown (B). GAPDH was used as an internal control to normalize the expression levels of these genes.;; (p;, 0.05),

    ;; (p;, 0.01) indicates that expression level of gene was greater or lower in treatment cells than in control cells (AC).

4 DISCUSSION

    This study proved that GBE had potential efficacy to prevent insulin resistance. And the proper molecular mechanism driving this process was discussed.

    As we known, TZDs were prevalent drugs used in type II diabetes mellitus therapy. They were thought as PPAR agonists [24] and improved downstream insulin signaling in type II diabetic patients [25]. On the one hand, they improved glucose tolerance and enhanced insulin sensitivity; on the other hand, TZDs increased weight of patients, too [24, 26]. It is unclear whether gaining weight in this way could do further harm to diabetic patients. But it is well known that obesity is a major risk factor for insulin resistance and type II diabetes mellitus. By contrast, GBE suppressed overmuch glucose ingestion when enhancing glucose tolerance in our experiments. Moreover, although GBE decreased glucose ingestion in normal status, it didn’t induce insulin resistance. Longtime (3 months) ingesting

     7

     http:///week114

    GBE by normal glucose-tolerant individuals caused a significant increase in pancreatic beta-cell insulin response [27]. The effect of GBE on glucose (improved glucose tolerance and inhibited overmuch glucose uptake) made us believe that GBE has a potential role in diabetes therapy.

    Liver, as a key metabolic organ, is bifunctional in glucose metabolism, namely utilization and production of glucose. And it played a crucial role in regulating energy balance. So, the hepatic insulin resistance was deemed to be chiefly responsible for type II diabetes [28]. In our experiments, GBE improved glucose tolerance in hyperinsulinism-induced hepatocytes. It suggested that GBE prevented insulin resistance in liver. To further explore its signaling pathway, we determined mRNA levels of related genes and glucokinase activity. Our data showed that in normal status, GBE enhanced expressions of PPAR, IRS-2 and G6Pase; in insulin resistance status, GBE stimulated expressions of IRS-2 and GLUT2, and repressed SREBP1c expression. Interesting, there was a paradoxical result in our data. On the one hand, GBE improved glucose tolerance. On the other hand, GBE also increased G6Pase expression, which was thought a key enzyme in glucose synthesis. Considering glucose ingestion was increased in insulin resistance status, a rational explanation for this result was that GBE enhanced glucose tolerance by accelerating metabolic rate, not by merely ingesting and depositing glucose [29].

    Glucokinase (GK) is main HKs in liver and plays key role in regulating glucose phosphatization. In our experiment, its activity did not change after GBE treatment. The data suggested that GBE did not exert its effects on glucokinase. It should be noted that IRS-2 expression was improved after GBE treatment both in normal status and insulin resistance status. Since IRS-2 was a crucial element in downstream insulin signaling, its expression was closely relational with insulin signaling transduction. Researchers found that deficiency of IRS-2 caused insulin resistance [30]. So we suggested that GBE exerted its effects mainly on IRS-2 expression. Moreover, our data showed that the increase of IRS-2 was followed by the decrease of SRBEP1c. It indicated there was an inner link between them. The results of Tomohiro supported our supposition. They found SREBP1c directly suppressed IRS-2 transcription in hepatocytes [31]. So we suggested that GBE mainly improved insulin action by enhancing IRS-2 transcription.

    In summary, our data support the notion that GBE improves glucose tolerance in hyperinsulinism-induced L-02 cells. And the study also provides a base to further explore its signaling pathway.

REFERENCES

    [1] Schmid, W. Ginkgo thrives. Nature 1997; 386: 755.

    [2] Della Loggia R, Sosa S, Tubaro A, et al. Anti-inflammatory activity of some Ginkgo biloba constituents and

    of their phospholipid-complexes. Fitoterapia 1996; 67: 257-264.

    [3] Bombardelli E, Cristoni A, Curri SB. Activity of phospholipid-complex of Ginkgo biloba dimeric flavonoids

    on the skin microcirculation. Fitoterapia. 1996; 67: 265-273.

    [4] Kazumasa Shinozuka, Keizo Umegaki, Yoko Kubota, Naoko Tanaka, Hideya Mizuno, Jun Yamauchi, Kazuki Nakamura, Masaru Kunitomo. Feeding of Ginkgo biloba extract (GBE) enhances gene expression of hepatic cytochrome P-450 and attenuates the hypotensive effect of nicardipine in rats. Life Sciences. 2002; 70:

    2783-2792.

    [5] Tomomi Sugiyama, Yoko Kubota, Kazumasa Shinozuka, Shizuo Yamada, Jian Wu, Keizo Umegaki. Ginkgo biloba extract modifies hypoglycemic action of tolbutamide via hepatic cytochrome P450 mediated mechanism in

    8

     http:///week114 aged rats. Life Sciences. 2004; 75: 1113-1122.

    [6] Saponara R, Bosisio E. Inhibition of cAMP-phosphodiesterase by biflavones of Ginkgo biloba in rat adipose

    tissue. Journal of Natural Products 1998; 61: 1386-1387.

    [7] Mario Dell’Agli, Enrica Bosisio. Biflavones of Ginkgo biloba stimulate lipolysis in 3T3-L1 adipocytes.

    Planta Med. 2002; 68: 76-79.

    [8] Boveris, A. D., Galatro, A., Puntarulo, S. Effect of nitric oxide and plant antioxidants on microsomal content of lipid radicals. Biol Res. 2000; 33: 159-165.

    [9] Nian hong, Song Baohui and Wang Wan. Antioxidative Hress Effect of Ginkgo Biloba Extract to Experimental Diabetes Rats. Journal of Mudanjiang Medical College 2004; 25: 3-6.

    [10] Li Xin, Liao Xinxue and Liao Xiaoxing. The preventive and therapeutic effect of Ginkgo extract on atherosclerosis. Chin J Emerg Med. 2004; 13: 609-611.

    [11] Huang Peili, Feng Gaoqian, Zhang Shuhua, Wang Hui. Effect of Ginkgo Biloba L Leaves on Oxidation of Human Low Density Lipoproteins in vitro. Journal of Hygiene Research 2004; 33: 453-454.

    [12] Ni Haixiang, Luo susheng and Huang qi. Effect of GBE on Plasma Oxidization-modified Low Density Lipoprotein in Patients with Type-2 Diabetes Mellitus. Zhe Jiang Zhong Xi Yi Jie He Za Zhi 2000; 10: 454-456.

    [13] Bernardczyk-Meller, J., Siwiec-Proscinska, J., Stankiewicz, W., et al. Influence of Eqb 761 on the function

    of the retina in children and adolescent with long lasting diabetes mellitus--preliminary report. Klin Oczna. 2004; 106: 569-571.

    [14] Bell GI, Kayano T, Buse JB, et al. Molecular biology of mammalian glucose transporters. Diabetes Care

    1990; 13: 198-208.

    [15] Riaz A. Memon, Laurence H. Tecott, Katsunori Nonogaki, et al. Up-Regulation of Peroxisome

    Proliferator-Activated Receptors (PPAR-a) and PPAR-g Messenger Ribonucleic Acid Expression in the Liver in Murine Obesity: Troglitazone Induces Expression of PPAR-g-Responsive Adipose Tissue-Specific Genes in the Liver of Obese Diabetic Mice. Endocrinology 2000; 141: 4021-4031.

    [16] Jay D. Horton, Joseph L. Goldstein, and Michael S. Brown. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 2002; 109: 11251131.

    [17] Patti Mary-Elizabeth, Sun Xiao-Jian, Bruening Jens C., et al. 4PS/Insulin Receptor Substrate (IRS)-2 Is the

    Alternative Substrate of the Insulin Receptor in IRS-1-deficient Mice. J. Biol. Chem. 1995; 270: 24670-24673.

    [18] Kristina I. Rother, Yumi Imai, Matilde Caruso, et al. Evidence that IRS-2 phosphorylation is required for

    insulin action in hepatocytes. J. Biol. Chem. 1998; 273: 1749117497.

    [19] Yeh Hsiu-jeng, Chu Ten-ho and Shen Tin-wu. Ultrastructure of Continuously Cultured Adult Human Liver Cell. Acta Biologiac Experimentalis Sinica 1980; 13: 361-364.

    [20] Garvey, W. T., Olefsky, J. M. and Marshall, S. Insulin Receptor Down-regulation Is Linked to an Insulin-induced Postreceptor Defect in the Glucose Transport System in Rat Adipocytes. J. Clin. Invest. 1985; 76:

    22-30.

    [21] PR Pryor, SC Liu, AE Clark, et al. Chronic insulin effects on insulin signaling and GLUT4 endocytosis are reversed by metformin. Biochem. J. 2000; 348: 83-91.

    [22] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976; 72: 248-54.

    [23] Zhou Jianxin, Zhong Xiaolin, LI Rongfen, et al. Changes of hepatic glucokinase, muscular hexokinase,

    blood glucose, plasma lactate, and erythrocytic ATP after scalding in rats. Acta Academiae Medicinae Militaris Tertive 1994; 16: 178-180.

    [24] Hannele Yki-Jarvinen. Thiazolidinediones. N Engl J Med. 2004; 351: 1106-18.

    [25] Yoshinori Miyazaki, Helen He, Lawrence J. Mandarino, and Ralph A. DeFronzo. Rosiglitazone Improves

    9

     http:///week114

     Downstream Insulin Receptor Signaling in Type 2 Diabetic Patients. Diabetes 2003; 52: 19431950.

    [26] YUTAKA MORI, YUICHI MURAKAWA, KAZUHISA OKADA, et al. Effect of Troglitazone on Body

    Fat Distribution in Type 2 Diabetic Patients. Diabetes Care 1999; 22: 908912.

    [27] Kudolo GB. The effect of 3-month ingestion of ginkgo biloba extract on pancreatic beta-cell function in

    response to glucose loading in normal glucose tolerant individuals. Journal of Clinical Pharmacology 2000; 40:

    647-654.

    [28] Cullen M. Taniguchi, Kohjiro Ueki and C. Ronald Kahn. Complementary roles of IRS-1 and IRS-2 in the

    hepatic regulation of metabolism. J. Clin. Invest. 2005; 115: 718727.

    [29] Kudolo GB. The effect of 3-month ingestion of ginkgo biloba extract (EGb 761) on pancreatic beta-cell

    function in response to glucose loading in individuals with non-insulin-dependent diabetes mellitus. Journal of

    Clinical Pharmacology 2001; 41: 600-611.

    [30] Naoto Kubota, Kazuyuki Tobe, Yasuo Terauchi, et al. Disruption of Insulin Receptor Substrate 2 Causes

    Type 2 Diabetes Because of Liver Insulin Resistance and Lack of Compensatory;:-Cell Hyperplasia. Diabetes

    2000; 49: 18801889.

    [31] Tomohiro Ide, Hitoshi Shimano, Naoya Yahagi, et al. SREBPs suppress IRS-2-mediated insulin signaling in

    the liver. Nat Cell Biol. 2004; 6: 351-357.

     10

Report this document

For any questions or suggestions please email
cust-service@docsford.com