DOC

Effect of Rho Kinase Inhibition on the Development of Nephropathy

By Melanie Boyd,2014-06-29 16:28
10 views 0
Effect of Rho Kinase Inhibition on the Development of Nephropathy

    Effect of Rho Kinase Inhibition on the Development of Nephropathy in Uninephrectomized Diabetic Rats

    R. Komers, T.T. Oyama, D.R. Beard, C. Tikellis, B. Xu, D.F. Lotspeich, and S. Anderson

SUPPLEMENTAL MATERIAL

    Supplemental methods.

    Isolation of total RNA, synthesis of cDNA and quantitative Real-Time PCR. Gene expression for transforming growth factor-ß (TGF-ß), connective tissue growth factor (CTGF), fibronectin, collagens I, III and IV, osteopontin, p65 NFB and nephrin

    were assessed by real-time quantitative RT-PCR using the TaqMan system based on detection of accumulated fluorescence (ABI Prism 7500, Perkin-Elmer Inc., PE Biosystems, Foster City, CA, USA). Renal cortex was homogenized in TRIZOL (Life Technologies Inc., Gaithersburg, MD, USA). Total RNA was isolated and cDNA was

    TMsynthesized with a reverse transcriptase reaction (Superscript First Strand Synthesis

    System for RT-PCR, Life Technologies Inc.). The generation of amplicons was defined as the point during cycling when amplification of the PCR product is first detected above the threshold setting. Gene expression was normalized to 18S mRNA and samples from C-VE rats were then used as the calibrator with a given value of 1. All other groups were compared with this calibrator group (1). The primer sequences are listed in Supplemental Table 1.

    Immunoblotting. Western blot analysis was performed as previously described (2, 3). In brief, kidney cortices were homogenized in lysis buffer containing protease and phosphatase inhibitors. Denatured proteins were separated through an SDS-

    polyacrylamide gel and transferred to PVDF membranes (Bio-Rad, Hercules, CA), and blocked with TBS-T containing 5% nonfat dry milk. Following blocking, membranes were incubated overnight with primary antibodies raised against phospho-Threonine 853-MYPT (P-MYPT, 1:600, Cell Signaling, Beverly, MA); fibronectin (1:2500, Sigma), TGF-ß (1:600, Cell Signaling), CTGF (1:800, Santa Cruz, Santa Cruz, CA), collagen I (1:1500, Abcam, Cambridge, MA), nephrin (1:600, Santa Cruz, 1:1500, Abcam,

    Cambridge, MA), VEGF (1:800, Santa Cruz), FSP1/S100A4 (1:2500, Abcam), ;-SMA

    (1:500, Abcam), vimentin (1:600, Santa Cruz), phospho-Threonine 489-p70 S6 Kinase (p-S6K, 1:500, Cell Signaling); and phospho-Serine 65-4E-BP1 (p-4E-BP1, Cell Signaling). Collagen I was analyzed under non-reducing conditions as recommended by the manufacturer. Immunodetection was accomplished using secondary antibodies conjugated with horseradish peroxidase (HRP) for 60 min (1:80,000, Pierce) in TBS-T containing 5% nonfat dry milk. Visualization was performed with an enhanced chemiluminiscence western-blotting kit (Supersignal West Dura, Pierce, Rockford, IL). Following the detection of phosphoproteins, the membranes were stripped and reincubated with an antibody against total MYPT (Cell Signaling, 1:800), total S6K (Cell Signaling, 1:800), or total 4E-BP1 (Cell Signaling, 1:800) and further processed as described above. To confirm equality of loading, all membranes were stripped and reanalyzed for actin expression (Santa Cruz). Western blot analyses were performed at

    least in quadruplicate.

Immunohistochemistry. For immunohistochemical analysis, the formalin-fixed,

    paraffin-embedded kidneys were processed as previously described (2). The same antibodies as described above were used for immunohistochemical detection of

    FSP1/S100/A4, ;-SMA, and vimentin. Sections were deparaffinized, and pretreated by steaming in 10% CITRA buffer (BioGenex, San Ramon, CA). After blocking, the slides were incubated overnight at 4?C with primary antibody (diluted 1:100) or with the same concentration of non-immune mouse IgG as a control. Endogenous peroxidase activity was blocked with 3% HO solution in methanol. The primary antibody was localized 22

    using the Vectastain ABC-Elite peroxidase detection system (Vector Laboratories, Burlingame, CA). This was followed by reaction with diaminobenzidine as chromogen and counterstaining with hematoxylin (Sigma). Sections of each diabetic kidney were processed in parallel with appropriate control tissue.

REFERENCES

1. Tikellis C, Thomas MC, Harcourt BE, et al. Cardiac inflammation associated with

    a Western diet is mediated via activation of RAGE by AGEs. Am J Physiol

    Endocrinol Metab 2008; 295: E323-330.

2. Komers R, Schutzer WE, Reed JF, et al. Altered endothelial nitric oxide synthase

    targeting and conformation and caveolin-1 expression in the diabetic kidney.

    Diabetes 2006; 55: 1651-1659.

3. Komers R, Lindsley JN, Oyama TT, et al. Renal p38 MAP kinase activity in

    experimental diabetes. Lab Invest 2007; 87: 548-558.

Supplemental table 1.

    Effect of Rho Kinase Inhibition on the Development of Nephropathy in Uninephrectomized Diabetic Rats

    R. Komers, T.T. Oyama, D.R. Beard, C. Tikellis, D.F. Lotspeich, and S. Anderson

Suppl. Table 1. Primer sequences used for rtPCR.

    Gene 5’-oligonucleotide, 5’>3’ probe (MGB), 5’>3’ 3’-oligonucleotide, 5’>3’

    TGFß GAGGTGACCTGGGCACCAT 6- FAM CATGACATGAACCGACC GGCCATGAGGAGCAGGAA CTGF TGGCCCTGACCCAACTATGA 6- FAM ACTGCCTGGTCCAGAC CTTAGAACAGGCGCTCCACTCT Fibronectin CATGGCTTTAGGCGAACCA 6- FAM CCCCGTCAGGCTTA CATCTACATTCGGCAGGTATGG Collagen I TGCCGATGTCGCTATCCA 6- FAM CCTTCCTGCGCCTGA TCTTGCAGTGATAGGTGATGTTCTG Collagen III GGAAAAGATGGATCAAGTGGACAT 6- FAM CCCATTGGACCACCAGG GAGCCCTCAGATCCTCTTTCAC Collagen IV CACTATGAAAACCGTAAAGTGCCTTA 6- FAM ATTTGCGTAACTAACACACC GCAAACAGAGGCCAACGAA NFKappaB p65 ACCGTGCCCCCAACACT 6-FAM AGCTCAAGATCTGCCG CAAGGCAGCTCCCAGAGTTC Osteopontin GCACACAAGCAGACGTTTTGA 6-FAM ATCACCTCGGCCGT TCGGGATACTGTTCATCAGAAACA Nephrin AGTGGCTGAAGAACGGTAAACC 6- FAM AGCATGCCCAGGCAG TGAGCCGAGCTCCATGGT FSP1/S100A4 GAGGAGGCCCTGGATGTAATAGT 6- FAM TCCACCTTCCACAAAT GTCACCCTCGTTGCCTGAGT

Report this document

For any questions or suggestions please email
cust-service@docsford.com