DOC

Cloning and Functional characterization of three Superoxide Dismutases genes from halophyte Salicornia europaea and Thellungiella halophila

By Clara Arnold,2014-09-10 21:19
5 views 0
Cloning and Functional characterization of three Superoxide Dismutases genes from halophyte Salicornia europaea and Thellungiella halophila

    豆丁网论文(http:///msn369

    Cloning and Functional characterization of three

    Superoxide Dismutases genes from halophyte Salicornia

    europaea and Thellungiella halophila 1122225 Wu Fan, Yu Mei, Lu Maolong, Li Juan, Wang Rongfu, Wang Xianlei, 1111Sun Qizhen, Zang Jie, Xu Kai, Ji Hu

    (1. Academy of Life Science, Anhui Agricultural University, HeFei 230036;

    2. Center of Biotechnology, Anhui Agricultural University, HeFei 230036) Abstract: In order to study the halophyte salt-tolerance mechanism, we cloned the manganese (Mn)

    10 and Cu/Zn superoxide dismutase (SOD) full-length cDNAs from Salicornia europaea by RACE method for the first time, sequence analysis indicated that the MnSOD gene (GenBank accession number: JQ061158) comprises an open reading frame of 699 bp, encoding 233-amino acid polypeptide with a predicted molecular mass of 25.7 kDa. Correspondingly, the Cu/ZnSOD gene (GenBank accession number: JQ061160) consists of an open reading frame of 684 bp which encodes a protein of 228 amino

    15 acids with a predicted molecular mass of 23.3 kDa. The prokaryotic expression vectors pET30-SeMSD, pET30-SeCSD and pET30-ThMSD were constructed, and the target proteins were expressed successfully in BL21 Escherichia coli. Through optimization of the inducing concentration of Isopropyl β-D-Thiogalactopyranoside (IPTG), we tested the salt tolerance of these three superoxide dismutases under 6.5% and 7.5% NaCl, and the results demonstrate that the recombinants BL21 (pET30-SeMSD)

    20 and BL21 (pET30-ThMSD) show better tolerance to salinity stress in comparison with the control stain BL21 (pET30), but the recombinant BL21 (pET30-SeCSD) has not displayed increased salt tolerance. Keywords: Molecular Cloning; Salicornia europaea; SeMSD; SeCSD; ThMSD; Salt tolerance

    0 Introduction

    25 Salinity is one of the major abiotic stress factors limiting the plant productivity (ZHU JK 2001). Salt stress not only leads to available water deficiency, resulting in dehydration and osmotic stress, but also produces various reactive oxygen species due to the lacking of carbon dioxide (Dhariwal et al. 1998). The reactive oxygen species (ROS) include hydrogen peroxide

     -2), etc (Hen et al. 1997). The ROS can cause (H 0), hydroxyl radicals (OH), super oxide anion (022

    30 the protein denaturation, DNA mutation, and membrane lipid peroxidation (Wang et al. 2005). To minimize the deleterious effects of ROS, plants have evolved enzymatic and non-enzymatic mechanisms to scavenge ROS (Allen 1995). Superoxide dismutases (SODs, EC1.15.1.1.) are

     metalloenzymes which exist widely in plants, forming the first line of defense against ROS with2catalyzing the dismutation of superoxide anion (0) to 0 (Alscher et al. 2002; Bowler et and H0 2 22

    35 al. 1992). According to the metal cofactors at the active site, SODs can be divided into three classes: Cu/ZnSOD, FeSOD and MnSOD (Fridovich 1986). The subcellular localization reveals the primary forms of SODs are cytosolic Cu/ZnSOD, the mitochondrial MnSOD, and the chloroplastic Cu/Zn and FeSODs (Bowler et al. 1994).

    Due to the physiological role in response to environmental stresses, SOD genes have been

    40 extensively characterized in plant species such as Arabidopsis Cu/ZnSOD (Kliebenstein et al.

    1998), Wheat Cu/ZnSOD (Wu et al. 1999), and rice Cu/ZnSOD (Sakamoto and Scandalios 1995), Peach MnSOD (Bagnoli et al. 2002), Zea MnSOD (White JA et al. 1988), and rice MnSOD (Feng W et al. 2006). The overexpression of SOD genes in different plants improved the tolerance to various stresses. For instance, the expression of the pea MnSOD gene in the rice chloroplasts

     45 could enhance the capability of defense against methyl violet essence and drought stress (Wang et

Brief author introduction:Fan Wu, (1987-), Mr, MSC, Plant molecular biology.

    Correspondance author: Mei Yu, (1968-), Mis, Professor, Biochemistry and Molecular Biology. E-mail:

    yumeizz@163.com

    - 1 -

    豆丁网论文(http:///msn369

    al. 2005). Gupta et al. (1993) reported that the overexpression of Cu/ZnSOD gene in tobacco plants conferred increased resistance to oxidative stress. Tertivanidis et al. (2004) transferred a tomato SOD gene into sugarbeet, and the transgenic plants displayed increased tolerance to methyl viologen and pure cercosporin. Yoo et al. (1999) reported that the recombinant yeast cells

    50 containing the human SOD gene were more tolerant to Paraquat and menadione-mediated oxidative stresses.

    Nonetheless, few reports have been found about cloning SOD genes and transgenic researches from Salicornia europaea. Salicornia europaea, a typical halophyte that is capable of

    surviving in 3.5% salinity. Thellungiella halophila with a close relative of Arabidopsis can

    55 withstand 500 mM NaCl (ZHU JK 2001). In this study, we characterized the MnSOD and Cu/ZnSOD gene from Salicornia europaea, and transferred these two genes and ThMSD into

    BL21 Escherichia coli by constructed prokaryotic expression vectors. We demonstrated through optimizing the IPTG concentration that the recombinants BL21 (pET30-SeMSD) and BL21 (pET30-ThMSD) exhibited increased resistance to salinity stress under 6.5% and 7.5% NaCl..

     60 1 Results

1.1 Isolation and sequence analysis of the S. europaea MnSOD and Cu/ZnSOD

    full-length cDNAs

    To isolate MnSOD and Cu/ZnSOD cDNAs from Salicornia europaea, the degenerate

    primers were designed based on the conserved domains of MnSOD and Cu/ZnSOD among several

    65 plant species. The two resulting fragments about 300bp were sequenced and highly homologous to other plant MnSODs and Cu/ZnSODs. To obtain the full-length cDNAs, RACE strategy was used to amplify the 3’ and 5’ cDNA ends. The full-length SeMSD cDNA is 1053bp long and contains a 59 bp 5- untranslated region (UTR), a 699 bp open reading frame encoding 233 amino acids, a 295bp 3’ -UTR with an AATAAA polyadenylation signal and a Poly (A) tail, and the amino acid

    70 polypeptide has a predicted molecular mass of 25.7 kDa. The deduced SeMSD shows highest identity with the enzymes from Gossypium hirsutum (83%) and Tamarix androssowii (81%) at the

    amino acid level. In addition, the multiple alignment and phylogenetic analysis show strong conservation in several regions (Fig. 1A and 1B). The full-length SeCSD cDNA is 985bp long including a 43bp 5- untranslated region (UTR), a 684bp open reading frame encoding 228 amino

    75 acids with a predicted molecular mass of 23.3 KDa, a 258bp 3’ -UTR with a consensus

    polyadenylation signal (AATAAA) and a Poly (A) tail. The putative Cu/ZnSOD protein exhibits 81% identity with the Spinacia oleracea Cu/ZnSOD, 80% identity with the Chenopodium murale

    Cu/ZnSOD (Fig. 2A and 2B).

1.2 Expression of the SeMSD, SeCSD and ThMSD genes in BL21 (DE3)

    80 To further characterize SeMSD, SeCSD and ThMSD genes, we constructed three prokaryotic expression vectors. The three SOD genes were well expressed in E.coli BL21 (DE3) when induced by 0.4mM IPTG, as shown in 15% SDS-PAGE profiles (Fig. 3). SDS-PAGE analysis indicated that the molecular mass of the three expressed proteins were approximately 25-27 KDa, consistent with the predicted molecular weight of the three SODs with a 5.5 KDa polyhistidine

    85 tag.

1.3 Salt resistance analysis of the SeMSD, ThMSD and SeCSD genes

    To study the salt-stress defense of these three SOD genes, the SODs were ligated into the fusion expression vector pET30a, and the recombinants were transformed into BL21 (DE3). The

    - 2 -

    豆丁网论文(http:///msn369

     same number of recombinant BL21 harboring pET30-SODs and the control BL21 harboring

    pET30a were inoculated into liquid LB containing different NaCl concentrations. Compared with 90

     the control BL21 (pET30), the growth of recombinants displayed no significant difference in -1 ?LKan). However, by elevating the salinity to 6%, we normal medium (0.4 mM IPTG, 50mg

     found that the ODof recombinant BL21 (pET30-ThMSD) was about 1.4-2.2 fold higher than 600 that of the control strains before 11 hours, despite the fact that the ODof control BL21 (pET30) 600

    surpassed the BL21 (pET30-ThMSD) with the extension of time. The recombinant BL21 95

     (pET30-SeMSD) and BL21 (pET30-SeCSD) exhibited no growth advantage at all times (Fig. 4). Considering the growth inhibition derived from the excess IPTG, we optimized the IPTG

     concentration and confirmed that the SOD proteins expressed well, the growth can not be affected adversely simultaneously. By analyzing the data (Fig. 5 and 6) we chose 0.025 mM as the optimal

    IPTG concentration. The recombinants and control strains were inoculated into the liquid LB 100 -1 (0.025 mM IPTG, 50mgLKan) under 6.5% and 7.5% salinity (Fig. 7A and 7B). Under 6.5% ? salinity the ODof BL21 (pET30-SeMSD) was 1.2-1.4 fold of the control BL21 (pET30a) 600 before 17 hours, afterwards the growth advantage faded away. The ODof BL21 600 (pET30-ThMSD) reached 2.4 fold of the control strains at the early stage. While in 7.5% salinity,

    the ODof BL21 (pET30-ThMSD) was 2.3-5 fold higher in comparison with the control BL21 105 600

     (pET30a), the ODof BL21 (pET30-SeMSD) attained to almost 2 fold of the BL21 (pET30a) at 600 25 hours. In general, our results demonstrated that with the increased salinity the recombinants

     BL21 (pET30-ThMSD) and BL21 (pET30-SeMSD) showed better growth and the growth of the recombinants BL21 (pET30-SeCSD) is relatively slower.

     110 Tab.1 Primers used in this paper

     Name Sequence (5’ to 3)

    SeMSDF1 THAARTTYAAYGGNGGNGG SeMSDR1 CCNCCNCCRTTRAAYTTDA

    SeMSD3race CACTGGGTTGGGCTATTGATTCAC

    TTGACACCACTCCAAATCAGGACCCG

    TAGTTACCAGCGGGTCCTGATTTG SeMSD5race

    AGCTTTTTCGACTGGGCGTCATTTCC

    CTCTCTCTCTCTCGTCGTCTTACC SeMSDF2

    TGAACAGAAGATCTGCACACAATC SeMSDR2

    GGAATTCCATATGGCGCTTCGAGCTCTG SeMSDF3

    CCGGATATCTTAGTGACTGGGGCACTCTTTCT SeMSDF3

    GGNGAYACNACNAAYGGNTG SeCSDF1 TCRTGNCCNCCYTTNCC SeCSDR1 AATGGCATGACACATGGTGCTCC SeCSD3race TCCATTAAGTGGGCCAAATTCGGTCG TCTACCTACGACCGAATTTGGCC SeCSD5race ATGTCGTACTTCGTCTTCCGGAGCACC ACTCCACTTAAGCCTGAAGCTC SeCSDF2 AACTGCTAACAACATTGCATCC SeCSDR2 GGAATTCCATATGCAGCAAGTAGCATTAGCAG SeCSDF3 CCGGATATCTCACATAGGAGTTAATCCAACAACA SeCSDR3 GGAATTCCATATGGCGATTCGTTCTGTAGC ThMSDF1 CCGGATATCTCAGTTGCATTCCTTCTCATAA ThMSDR1

115

120

    - 3 -

    豆丁网论文(http:///msn369

     A

     B

     Gossypium hirsutum 61 Salicornia europaea 57 Camellia sinensis 49 Vitis vinifera 45 Populus trichocarpa Arabidopsis thaliana

     Triticum aestivum

    125 Fig.1 The predicted amino acid sequence of S. europaea MnSOD shows high identity with other plant MnSOD proteins. (A) Alignment of the predicted amino acid sequences of MnSODs from different plants. (B) Molecular phylogenic tree of the amino acid sequences of the plant MnSOD gene family. A

130

135

    - 4 -

    豆丁网论文(http:///msn369

     140 B

     Gossypium hirsutum 40

    Bruguiera gymnorhiza 70 Vitis vinifera Populus trichocarpa 39 Pinus pinaster

    Arabidopsis thaliana Spinacia oleracea 47

    europaeaSalicornia 97

     Fig.2 The predicted amino acid sequence of S. europaea Cu/ZnSOD shows high identity with other plant Cu/ZnSOD proteins. (A) Alignment of predicted amino acid sequences of Cu/ZnSODs from different plants. (B) Molecular phylogenic tree of the amino acid sequences of the plant Cu/ZnSOD gene family

    145

     Fig.3 The SDS-PAGE analysis of the SeMSD, ThMSD and SeCSD gene expressed in E.coli BL21

    - 5 -

    豆丁网论文(http:///msn369

     150 Fig.4 The growth of recombinants in liquid LB (6% NaCl, 0.4 mM IPTG).

     Fig.5 The SDS-PAGE analysis of recombinants cultivated under different IPTG concentrations 00.02 mM0.025

    mM0.03 mM0.035 mM0.04 mM0.045 mM.

    - 6 -

    豆丁网论文(http:///msn369

     155 Fig.6 The growth of recombinants under different IPTG concentrations 00.02 mM0.025 mM0.03 mM0.035 mM0.04 mM0.045 mM. A

160

165

    - 7 -

    豆丁网论文(http:///msn369

170 B

     Fig.7 The recombinants BL21 (pET30-ThMSD) and BL21 (pET30-SeMSD) exhibit increased salt tolerance. (A) The growth of recombinants under 6.5% NaCl concentration. (B) The growth of recombinants under 7.5% NaCl concentration.

     175

     2 Discussion In this work, we have characterized the MnSOD and Cu/ZnSOD cDNAs from Salicornia

     europaea. Sequence analysis reveals a high degree identity with the SOD proteins from other plant species. Furthermore, the putative Mn -binding ligands are well conserved at H58, H102, D191,

    H195 (Whittaker MM and Whittaker JW 1998), the distinctive DXWEHXXY sequence which 180

     contains the last two metal ligands is present (Cheng W et al. 2006). The deduced copper- and zinc-binding sites are found at H119, H121, H136, H144, H153, H193, D156, which are

     conserved in other Cu/ZnSODs (Bannister et al. 1987). R216 which stabilizes the negatively charged superoxide (Tainer et al. 1983) is also present. The two Cysteine residues at 130 and 219

    which form a single disulfide bridge are important to maintain the polypeptide structure (Fridovich 185

     I 1986). The SeMSD, SeCSD and ThMSD genes were highly expressed by pET30a vector in E.coli BL21 (DE3). The molecular weight for MnSOD proteins ranges from 20 to 40 KDa as most

     reports shown (Babitha M P et al. 2002). On the 15% separated SDS-PAGE, the recombinant proteins run as single band around 25-27 KDa, a value consistent with the expected molecular

    mass. 190

     Previous reports have shown that the overexpression of SOD genes in plants confers the tolerance to salt stress, Yu Cheng Wang et al. (2010) transformed Tamarix androssowi MnSOD

     into poplar, the SOD enzyme activity of transgenic poplar increases by 1.4-4 times, and conferred much more resistance to salt stresses. Badawi et al. (2004) introduced the cytosolic Cu/ZnSOD of

    rice into chloroplasts of tobacco, and the transgenic plants were able to withstand 300 mM of 195

     NaCl stress. Tanaka et al. (1999) transferred yeast MnSOD into rice and the transformed rice tolerated up to 100 mM NaCl salinity stress. In order to determine the role of SeMSD, ThMSD

     and SeCSD gene in response to salt stress, the recombinants harboring the three genes were directly cultivated in high salinity medium with 0.025 mM IPTG. The apparent growth advantage

    of the recombinants implied that the SeMSD and ThMSD genes played an important role in 200

    defense against salt stress, however, the recombinant BL21 (pET30-SeCSD) had not shown

    increased salt tolerance. The putative amino acid sequence of SeCSD analyzed by TargetP 1.1

    - 8 -

    豆丁网论文(http:///msn369

     program contained a chloroplast transit peptide, and had high similarity with the chloroplast Cu/Zn superoxide dismutase of other plants, which revealed that the cDNA probably encoded a

    chloroplast Cu/ZnSOD. We speculated that the S. europaea chloroplast Cu/Zn superoxide 205 dismutase expressed in BL21 cytoplasm could not form active enzyme without appropriate location and enfoldment. 3 Materials and Methords

     3.1 Plant materials

    Seedlings of Salicornia europaea and T.halophila were grown in the greenhouse, after 2 210 months the leaves were collected for RNA extraction, then frozen in liquid nitrogen and stored at -

     70 ?. 3.2 Preparation of RNA and reverse transcription Total RNA was extracted from leaves with the RNA extraction kit (TaKaRa) according to the

    manufacturer’s instructions. Using total RNA as the template, the reverse transcription was 215 performed with random 6 primer referring to the PrimeSeript TM Reverse Transeriptase kit

     (TaKaRa), the resulting cDNA was used for PCR amplification. 3.3 Amplification and sequencing of the SeMSD and SeCSD gene fragment The degenerate primers (Table 1) were designed to recognize the conserved regions of plant SOD gene. PCR cycling conditions were as follows: 94?C for 3 min for initial denaturation; 30 220

     cycles of 94? for 30 s, 55? for 1 min, and 72? for 30 s; and 72? for 10 min for a final extension. The PCR products were purified (Promega) and cloned into pMD-19 Vector (TaKaRa),

     then transformed to DH5a. The positive clone was identified by blue/white screening and confirmed by PCR, the sequencing was accomplished by Sangon (China). 3.4 Expression of the SeMSD, SeCSD and ThMSD gene in BL21 (DE3) 225 According to the obtained two cDNA sequences and ThMSD cDNA (GenBank accession number: EF 140719), the primers (Table 1) with NedI and EcoRV sites were used to amplify the entire ORF. The resulting products were purified and ligated into the NedI and EcoRV sites of the pET30a Vector with T4 ligase. Subsequently, the three expression vectors confirmed by restriction enzyme digestion and sequencing were transformed into BL21 (DE3). The recombinants were 230 -1 inoculated into 20mL liquid LB (50mg?LKan) overnight at 37? in a shaking incubator (220rpm). The next day the cultures were inoculated to 5mL liquid LB by 1:100. When the cultures reached an optical density of 0.6 at 600 nm, 0.4mM IPTG was added into the medium for inducing protein expression, and the cells were cultivated for additional 4 hours at 180rpm, 1mL cultures were prepared for SDS-PAGE. 235 3.5 Optimization of the IPTG concentration

     The recombinants were inoculated into LB medium under different IPTG concentration of 0 0.02 mM0.025 mM0.03 mM0.035 mM0.04 mM0.045 mM, cultivated for 4 h and performed

     the SDS-PAGE for detecting the protein expression, the cell growth was measured by detecting the optical density (OD) at 600nm. The experiment was repeated in triplicate.

     240

    3.6 Salt resistance analysis of the recombinants

    The recombinants and control strain BL21 (pET30a) were inoculated into the liquid LB

    - 9 -

    豆丁网论文(http:///msn369

     -1 ?LKan) under 6.5% and 7.5% NaCl, cultivated at 37? and detected the(0.025 mM IPTG, 50mg OD. The experiment was repeated in triplicate, every experiment arranged 3 parallel samples. 600

    245 4 Conclusion In conclusion, to our knowledge, this is the first report describing the MnSOD and Cu/ZnSOD genes from Salicornia europaea, and we demonstrate the SeMSD and ThMSD are

     excellent salt tolerance genes through optimizing the IPTG concentration. The two genes may have great applications in genetic engineering of salt tolerance into plants. Currently, we are trying

    to transform these three genes into rice to further investigate theirs tolerance to various abiotic 250 stresses. Acknowledgements This work was supported by the Talent Introduction Program of Anhui Agricultural University, we thank Professor Yu and Lu for their advices of this work.

     255

     References [1] Alscher R G, Erturk N, Heath L S. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants[J]. J.Exp. Bot, 2002, 53, 1331-1341. [2] Allen R D. Dissection of oxidative stress tolerance using transgenic plants[M]. Plant Physiol. 1995, 107, 260 1049-1054. [3] Babitha M P, Prakash H S, Shekar S H. Purification and partial characterization of manganese superoxide dismutase from downy mildew resistant pearl millet seedlings inoculated with Sclerospora graminicola[J]. Plant Sci, 2002, 163, 917-924. [4] Badawi G H, Yamauchi Y, Shimada E, Sasaki R, Kawano N, Tanaka K, Tanaka K. Enhanced tolerance to salt 265 stress and water deficit by overexpressing superoxide dismutase in tobacco (Nicotiana tabacum) chloroplasts[J], Plant Sci, 2004,166, 919-928. [5] Bagnoli F, Giannino D, Caparrini S, Camussi A. Molecular cloning, characterisation and expression of a manganese superoxide dismutase gene from peach[J]. Mol Genetics Genomics, 2002, 267,321-328. [6] Bannister J V, Bannister W H, Rottilio G. Aspects of the structure, function and application of superoxide 270 dismutases[J]. Crit. Rev. Biochem, 1987, 22, 111-180.

     [7] Bowler C, Van C W, Van M M, Inze D. Superoxide dismutase in plants[J]. CRC Crit Rev Plant Sci, 1994, 13,

     199-218. [8] Bowler C, Van M M, Inze D. Superoxide dismutase and stress tolerance[J]. Annu. Rev. Plant Physiol, 1992, Plant Mol. Biol. 43, 83-116.

    275 [9] Cheng W, Tung Y H, Chiou T T, Chen J C. Cloning and characterisation of mitochondrial manganese

     superoxide dismutase (mtMnSOD) from the giant freshwater prawn Macrobrachium rosenbergii[J]. Fish Shellfish Immunol, 2006, 21, 453-466. [10] Dhariwal H S, Kawai M, Uchimiya H. Genetic engineering for abiotic stress tolerance in plants[J]. Plant Biotech, 1998, 15, 1-10.

    280[ 11] Feng W, Hongbin W, Bing L, Jinfa W. Cloning and characterization of a novel splicing isoform of the

    iron-superoxide dismutase gene in rice (Oryza sativa L)[J]. Plant Cell Rep, 2006, 24, 734-742.

     [12] Fridovich I. Superoxide dismutases[M]. Adv. Enzymol, 1986, 41, 61-97.

     [13] Gupta A S, Heinen J L, Holaday A S, Burke J J, Allen R D. Increased resistance to oxidative stress in transgenic plants that overexpress chloroplastic Cu/Zn superoxide dismutase[J]. Proc. Natl. Acad. Sci. USA, 1993,

    90, 1629-1633. 285

     [14] Hen B, Jensen R G, Bohnert. Increase resistance to oxidative stress in transgenic Plants by targeting mannitol biosynthesis to chloroplasts[J]. Plant physiol, 1997, 113, 1177-1183. [15] Kliebenstein D J, Monde R A, Last R L. Superoxide dismutase in Arabidopsis: an eclectic enzyme family with disparate regulation and protein localization[J]. Plant Physiol, 1998, 118, 637-650.

    [16] Wang F Z, Wang Q B, Kwon S Y, Kwak S S, Su W A. Enhanced drought tolerance of transgenic rice plants 290

    expressing a pea manganese superoxide dismutase[J]. J. Plant Physiol, 2005, 162, 465-472. [17] White J A, Scandalios J G. Isolation and characterization of a cDNA for mitochondrial manganese superoxide dismutase (SOD-3) of maize and its relation to other manganese superoxide dismutases[J]. Biochim Biophys Acta, 1988, 951, 61-70.

    [18] Whittaker M M, Whittaker J W . A glutamate bridge is essential for dimer stability and metal selectivity in 295 manganese superoxide dismutase[J]. J. Bio.Chem, 1998, 273, 22188-22193.

    [19] Wu G, Wilen R W, Robertson A J, Gusta L V. Isolation, chromosomal localization and differential expression

    of mitochondrial manganese superoxide dismutase and chloroplastic copper/zinc superoxide dismutase genes in

    wheat[J]. Plant Physiol, 1999, 2, 513-520.

    - 10 -

Report this document

For any questions or suggestions please email
cust-service@docsford.com