DOC

Activity 312 Rapid Pathogen Identification

By Rebecca Harris,2014-06-22 10:12
6 views 0
Activity 312 Rapid Pathogen Identification

Activity 3.1.2 Rapid Pathogen Identification

Websites and other information:

    Link to Google docs spread sheet:

    https://docs.google.com/spreadsheet/ccc?key=0AtQPlgTDegGldDA0SHk2LS0xOTc2YmFkcTJ0MXVwbUE

Link to NCBI BLAST page:

    The following information is found in database searches. Use the nucleotide BLAST page, Use Blastn to search for short, nearly exact

    matches. Refer to the following URL:

    National Center for Biotechnology Information. (n.d.) BLAST. Retrieved

    October 18, 2006 from http://www.ncbi.nlm.nih.gov/BLAST/

    - Click on “nucleotide blast” in the middle of the page

    - Copy and past your sequence in to the box under “enter Query Sequence”

    - Under “database”, click on the drop down box and select “nucleotide collection”

    - Click “BLAST” at the bottom of the page. It may take a few moments to search.

    - When you get your results you may need to do an internet search to find out

    more about the organism and/or the type of cells.

Lupita (day 3)

    This 362-nucleotide sequence was produced by sequencing a sample of Lupita’s

    lymph using universal primers (4 nucleotides).

    1 gaagtccggc cttccgagag ctagctgtcc gccgcggccc ccgcacgccg ggcagccgtc 61 cctcgccgcc tcgggcgcgc caccatgggg ccccggctca gcgtctggct gctgctgctg 121 cccgccgccc ttctgctcca cgaggagcac agccgggccg ctgcgaaggg tggctgtgct 181 ggctctggct gtggcaaatg tgactgccat ggagtgaagg gacaaaaggg tgaaagaggc 241 ctcccggggt tacaaggtgt cattgggttt cctggaatgc aaggacctga ggggccacag 301 ggaccaccag gacaaaaggg tgatactgga gaaccaggac tacctggaac aaaagggaca 361 ag

Felix (day 3)

    Samples of his lesions were taken and universal primers were used to sequence. The following 119-nucleotide sequence was generated:

    1 TTCCCTTCAA CTTGAAGCAC TTTCTTTATC AATTGAATCC CAAACCAAAA TCCCTCTCCT

    61 ACTCAAGCGT AACAATTTAT GAGTATAAGA ATATTTTCCA CCCTTCAATG TAATGTAAA

Ponds (day 3)

    Water samples were taken from the pond closest to GOP HQ. Sequencing with universal primers revealed two sequences. The first was 348 nucleotides:

    1 atggaaggga aacgtgccct cctgtggctg ctactgattg ctgcagcggc ctttcaattg 61 tccgcccagc actggtcgca cggactcagt ccaggtggca agagggaagc tcacactctg 121 tcagaagtga tggaaggtct accaaagagg agtgcatcgc tttgtgggag tgaatacagg 181 gacggttccc catataaaag gccagataga cttgaacaac tgcttaatct gatggaggga 241 gaaaatgtag cttatgactg aacaacaaaa aatgaacaga ttcaataaaa cactgcagtg 301 tcttctaaat aaaaaaaaaa aaaaaaaaaa aaaaaaaa

The second shotgun sequence was 180 nucleotides:

    1 aaaactgaat tagctaaatt attagctaaa caattatttg gttcagaaaa agaattaata 61 agatttgata tgagtgaata tatggaaaaa cattcaattt caagattaat tggttcacct 121 ccaggttata taggttattc agaaggagga caattaacag aacaagtttt taaaaaacct

Lionel (day 4)

    This 362-nucleotide sequence was produced by sequencing a sample Lionel’s rash-

    pustule using universal primers (4 nucleotides).

    1 gaattctggt tgatcctacc agtaatatac gcttgtctca aaggttaagc catgcatgtc 61 taagtacaaa cagatttaat gtgaaaccgc ataaggctca gtataacagc tataatttac 121 aagatcattt aactagttac ttggataact gtggaaaatc tagagctaat acatgcaaaa 181 tgcaggaacc tcgcggaacc tgtgcaatta ttagtcaaac caatcgtcct ccgtgacgct 241 ggagttgaaa tctggataat tttgttgatc gtatggtctc gcaccgacga cagatctttc 301 aaatatctgc cctatcaact attgatggta gtatagagga ctaccatggt tgcaacgggt 361 a

Naomi (day 4)

    This 120-nucleotide sequence was produced by sequencing a sample Naomi’s lymph using universal primers (4 nucleotides).

    1 ataggagtcgtcatcacatggataggaatgaattcacgcagcacctcactgtctgtgtcactagtattag 61 gggagtcgtgacattgtatttgggagttatggtgcaggccgatagtggttgcgttgtgagttggaaaaa

Ponds(day 4)

    More water samples were taken from the pond closest to GOP HQ. Sequencing with universal primers revealed two sequences. The first was 129 nucleotides:

    1 tttctgttta gtttcattac agatctggac atcctgtccc ttctagcttc atcagcttag 61 tagtctaagt agctcaagaa atcccgataa atcctttcct tccctgttac aaatgtatta 121 actaacctt

The second shotgun sequence was 249 nucleotides:

    1 cacgttgaac gcatattgca catcgtacta ccagtacgat gtacacattt ttgagtgcct 61 atatttatcc attcaactat acgcgccgcc cgcgcgcgta tgcgtagtga tgttttcccg 121 ccttcagtgc gcggtaaaac attgaagata gtcagacgtg gtggtgacac accgcggttg 181 atgaatacat cccactatgg cgcgctcgct cgccttgtgt tgtattccat cattcactaa 241 ctaactccct

Report this document

For any questions or suggestions please email
cust-service@docsford.com