
By Joan Long,2014-07-24 01:27
12 views 0




    ;Phylogeneticrelationshipsof18passerinesbasedonAdenylateKinase ;Intron5sequences



    ;Collegeof~lyeSciences,HeilongfiangUniversity,Harbin150080,RChina ;CollegeofWildlifeResources,NortheastForestryUniversity,Harbin150040,PRChina ;Abstract:The18speciesofbirdstudiedoriginallyareknowntobelongtomuscicapids,robinsandsylviidsofpasserines,butsomedis











    ;Keywords:molecularphylogeny;AdenylateKinaselntron5:passeriformes;monophyly ;Introduetion













    ;Sibley&Ahlquistfl990),inwhichPasseriformeswasdivided ;intotwosuborders:suboscinesandoscines.TheRestriction ;Foundationproject:TheprojectwassupportedbyHeilongjiangProvince ;PostdoctoralFund.

    -08 ;Received:2008-02-22;Accepted:200803












    ;FragmentLengthPolymorphism(RFLP)techniquehasbeen ;usedinavianphylogenetics.Inthistechnique,passerinemito- ;chondrialgenomeswerefoundtobegeneticallypolymorphic(Li ;eta1.2002).Threetitmicespecies(Parusbicolor,P.inornatus,P. ;wollweberi)intheNorthAmericawerestudiedbvGilland ;Slikasfl992)usingRFLP’andtheyfoundthatthesespecies

    ;originatedinthePlioceneorearlyPleistocene.Inaddition,DNA ;sequenceanalysishasalsobeenusedinaviansystematics,which ;providedmoreclassificationsystematicinformation.Adenylate ;KinaseIntron5(AK5)mayperfotinwellinrecoveringrelation

    ;shipsfrominterspeciestointerfamily(Shapiroeta1.200l1.Inthe ;presentstudy.wefocusedtheattentiononthephylogenyOfl8 ;speciesofpasserinesincludingmuscicapids,robinsandsylviids. ;Thephylogeneticrelationshipswerestudiedamongl8speciesof ;passerinesusingAdenylateKinaseIntron5(AK5)sequences ;(Shapiroeta1.200l1.Comparedwithearlierclassificationsys

    ;tems,newinsightswereprovidedabouttheirphylogeny. ;Materialandmethods


    ;Samplesof18speciesofpasserineswerecollectedfromthe ;Mao’ershanMountain,HeilongjiangProvince,China(Table1).

    ;AK5sequencesofFalcofemoralis(AF307890)wasdownloaded ;fromGenBankasoutgroups.

    ;66@vahoo.comDNAextraction,PCRamplificationandsequencing ;TotalgenomicDNAwasextractedusingstandard




    ;phenolchloroformextractions.Weobtainedtheprimersforam. ;plifngAK5sequencesfrompreviouspapers:AK5b+: ;5’ATTGACGGCTACCCTCGCGAGGTG3’.


    ;2001).Theprimersarelocatedintheexon5andexofl6ofAde. ;nylateKinasegene.AK5PCRmixturescontained1.25.UBlend ;TaqDNApolymerase,10xbufferof5,2-mMMgCL2,


    ;inafinalvolumeof50uL.Reactionmixturesweresubiectedto ;Table1.Speciesexaminedinthepresentstudy

    ;thefollowingPCRcyclingprotocol:withaninitial10minat ;94.C,followedby35cyclesof92.Cfor45s,5660.Cfor60s.

    ;and72.Cfor60s,andafinalextensionafterthelastcycleat ;72.Cfor5min.PCRproductswerepurifiedwithQIAquickPCR ;purificationkit(Qiagen).MostofPCRproductsweresequenced ;directlyandfewofthemweresequencedaftercloning.Se. ;quencingwasperformedbytheTaqDyeDeoxyTerminatorCy

    ;cleSequencingkit(ABI)andanalyzedonanautomatedABI ;sequencer.


    ;SequenceswereproofedwithDNAStarsoftwarepackageand ;performedsimilaritysearchingwithBlastintheNCBI.Align. ;mentsweremadewithClustalxfHall2OO1)(Version1.8)and ;furtheranalyseswereconductedwithMega3.0.

    ;Phylogeneticanalyseswerefirstundertakenusing ;NeighborJoiningJ),andconductedwithPhylip.Thedata ;werealsoanalyzedusingtheMaximum.Parsimony(MP)method. ;KimuraTwo.ParameterModelwasusedforbasesubstitution ;analysis.Transitionsandtransversionswereallincludedandall ;threesubstitutionsiteswereused.Substitutionratesofthreesites ;wereassumedtobedifferent,whichfollowedtheFdistribution ;withitsshapecoecientof0.5.Phylogenetictreeswereana. ;1yzedby1000bootstrapreplicates.



    ;Withinsertionsanddeletions,AK5sequencesdifferinlength ;from451to530bp.AK5genesofallspeciesinthisstudyhave ;theGTandAGdoubletsitesthatmarkthebeginningandendof ;theintron(Breathnacheta1.1977;Mount1982;Kellereta1. ;Springer

    ;1985;Mounteta1.1992).Weobtained35AK5completese. ;quences.whichweredepositedintoGenbank.Theaccession ;numbersareasfollows:DQ116460.DQ119491-DQ119520and ;DQ365012DQ365015.


    ;quenceswere16.8%,30.9%,22.4%,and29.9%,respectively. ;Thepercentagesofconservedsites.variableandparsi

    ;mony.informativesiteswere63.4%,36.6%and22.7%.respec. ;tively.


    ;ConsiderablelengthvariationswerefoundamongtheAK5se. ;quencesexamined.Thesequencescontainnumerousindels, ;whichinvolvebothsingleandmultiplenucleotides.Mostindels ;arefromsingleevolutionaryeventsfi_e..insertionordeletionof ;asinglenucleotideorstringofnucleotides).Forexample,there ;werefourdeletionssharedbytheP.maior,P.ater,P.palustris ;andP.montanus(nucleotidesites:2236.397406,417441.

    ;444469).Consequently,thesefourspecieshavetheshortest ;AK5sequences.Therewereoneunique5bpinsertionfCCTAT. ;nucleotidesites3236)andonelbpinsertions(G.nucleotide

    ;sites523)intheAK5sequencesofP.webbianusand1-I.rustica. ;respectively.Itisbelievedthattheseindelsrepresentunique ;evolutionaryeventsofunequivocalhomology,withnoreversa1. ;

    ;JournalofForestryResearch(2008)19(3):239-24424l ;Geneticdistances

    ;Geneticdistances(Table2)werecalculatedwithKimura ;TwoParameterMode1.Theaveragegeneticdistancebasedon ;AK5sequencesamong18speciesofpasserinesis0.086.The ;geneticdistancebetweenTarsigercyanurusandLusciniaeyane ;wasthesmallest(0,045)andthelargest(0.162)appearedbe

    ;tweenSittaeuropaeaandLusciniaeyane,Thegeneticdistances ;betweenSittaeuropaeaandotheroldworldwarblerswererela


    ;serines,whichmeansthatSittaeuropaeahasarelativelyclose ;relationshipwitholdworldwarblers.Thegeneticdistancebe

    ;tweenlongtailedtitsandoldworldwarblerswassmallerthan ;thatbetweenlongtailedtitsandparidsalso.whichmeansthat ;oldworldwarblershavecloserrelationshipwithlongtailedtits. ;Table2.PairwisedistancesbetweenAK5sequencesof18speciesofpasserinescomputedb


    ;numbersarepairwisedistancesandtheuppertrianglestandarderror) ;Phylogeneticanalyses


    ;structedbytheNJandMPmethods(Fig.11.Theresultsshowed ;thatthetwophylogenetictreefigureswerenotsimilarcom

    ;pletely,buttheyallcomprisethreemajorclades.Thefirstmajor ;cladewasmadeupofoldworldwarblers,longtailedtits,crow

    ;tits,barnswallowandsi~ids.Thesecondwasparidsandthe ;thirdwasrobinsandflycatchers.

    ;Theclusteringsofthel8passerinespeciesareapproximately ;alikeinthetwotreefigureswithslightdifferences.Inthefirst ;majorcladePhvlloscopusinornatusandPhylloscopustro



    ;tellalanceolatawasclusteredwithParadoxorniswebbianu.In ;theNJtreefigure,Aegithaloscaudatuswasclusteredwiththe ;fourwarblersabove,thenwithSittaeuropaea.ButintheMPtree ;figure,SittaeuropaeawasclusteredwithHirundorustica,then ;withAegithaloscaudatus.Inthesecondmajorclade,Paruspal- ;ustriswasclusteredwithParusmontanusformingonesmall ;clade.IntheNJtree,ParusmajorwasclusteredwithPar’tgsater

    ;tOformanothersmallclade,butintheMPtreefigure.Parus ;majorwasnotclusteredwithPaI’USater.Inthethirdmajorclade,

    ;FicedulamugimakiwasclusteredwithFicedulazanthopygia, ;andthenwithCyanoptilaeyanomelanatoformaclade.This ;cladethenclusterswithLusciniaeyaneandfinallywithTarsiger ;cyanurusintheMPtreefigure,butitclusterswithLuscinia ;eyanefirst,thenwithTarsigercyanurus(Fig.1). ;Diseussion


    ;Frompreviousresearches,nuclearintronsweremainlyusedto ;revealmediumrelationshipsbetweenintergenericandinterfami



    ;tochondrialgenesequences.Theresultsshowedthatnuclear ;intronscouldalsobeusedtoanalyzeintragenericrelationships. ;Alaterstudyshowedthatintronsequencescouldalsobeusedto ;analyzephylogeneticrelationshipsofcloselyrelatedspecies ;(Sladeeta1.1994).AstoAK5sequences.itmayperforillwellin ;recoveringrelationshipsamongjntermediatetodistantlyrelated ;congenericspeciesandbetweengenera(Shapiroeta1.2001). ;OIll”resultsshowedthatParispoultriesandParisMontanezwere


    ;tinguishedwithanalysisOfAK5sequences.Therefore.AK5 ;Springer


    ;242JournalofForestryResearch(2008)19(3):239-244 ;sequencesalsohavefineeffectivenessinanalyzingrelationships ;amongcloserelatedcongenericspecies.



    ;sylviids,threemainopinionsarecoexisting.First,muscicapids, ;turdidsandsylviidsshouldbelistedintothreesubfamiliesrMus

    ;cicapinae;TurdinaeandSylviinae)underthefamilyMuscicapi. ;dae(ZhengZuoxin2002);Second,muscicapidsandturdidsare ;listedintotwosubfamilies(MuscicapinaeandTurdinae)under ;thefamilyMuscicapidae.butsylviidsis1istedintothefamily ;Sylviidae(Sibidae,

    ;TurdidaeandSylviidae),(ZhengGuangmei2002;Howardeta1. ;2003).Itshouldbepointedoutthatrobinsareisolatedfrom ;TurdidaeandlistedintoSaxicolinaeunderMuscicapidaeinsome ;classificationsystems(Sibleyeta1.1990;Howardeta1.2003). ;butinothers,theyarestilllyinginTurdidae(ZhengZuoxin2002; ;ZhengGuangmei2002).Duetotheabsenceofotherspeciesof ;Turdidaeinourresearch.wearenotsurewhetherrobinsshould ;belistedintoSaxicolinae.whichisindependentofTurdidaeor ;not.AccordingtothephylogeneticanalyseiesconstructedwithAK5sequences ;rA:NJtree;B:MPtree)

    ;IntheclassificationsystemofSibley&Ahlquist(1990), ;paridsbelongtothesuperfamilySylvioidea.Theresultreveals ;thatparidshavecloserelationshipwithsylviids.Alstrometa1. ;(2006)studiedthesystematicstatusandthephylogeneticrela? ;tionshipsofsuperfamilySylvioidea,bycombiningmitochondrial ;CytbandmyoglobinintronIIsequences,andtheyreportedthat ;paridswereexcludedfromsuperfamilySylvioidea.Ttheircon? ;clusionsneedtobeexaminedfurtherduetohaving1esssample’s

    ;kindsandamountofparids.Inourstudy.theresultsfromgenetic ;distancebetweenparidsandsylviidsshowedthatparidsand ;sylviidshadlikelycloserrelationship.Fromphylogenetictrees ;Springer

    ;constructedbytwomethods,paridsalwaysgatherssylviidsfirst, ;soourresearchsupportSibley&Ahlquist’sclassifyingview?



    ;daebelongstothesuperfamilySylvioidea.Butintheresultsof ;Sheldon&Gil1(1996).SiaidaewasclosetoSturnidaeand ;TurdidaeofthesuperfamilyMuscicapoidea(Sheldoneta1.1996). ;OurresultssupporttheopinionofSibley&Ahlquist.butfurther ;studyshouldbeconductedinthefuture.

    ;IntheNJtreefigure,HirundorusticaclusterswithLocustella ;lanceolataandParadoxorniswebbianuswith1owbootstrap ;

    ;JournalofForestryResearch(2008)19(3):239-244243 ;value(only32%1.IntheMPtreefigure,warblersfirstcluster ;withHirundorusticaandthenwithLocustellalanceolatawith

    ;highbootstrapvalue,whichmeansthattherelationshipbetween ;Hirundorusticaandwarblershasacloserrelationshipthanthat ;betweenLocustellalanceolataandwarblers.Alstrometa1.(2006) ;alsosupportedtheopinionhavingacloserrelationshipbetween ;Hirundorusticaandwarblers.

    ;IntheclassificationsystemofSibley&Ahlquistfl990).the ;taxonomicpositionofcrowtitsisinTimaliini.Sylviinae.Sylvii

    ;dae,Sylvioidea,however,intheclassificationsystemofZheng ;Zuoxin(20021,crowtitsareinTimaliinaeandMuscicapidae.In ;anotherclassificationsystem,crowtitsturnouttobeParadoxor

    ;nithidae(ZhengGuangmei2002).Inourresults,Paradoxornis ;webbianusclusterswithLocustellalanceolata,whichsupports ;theopinionofSibley&Ahlquist.

    ;Intheclassificationsystemof(ZhengZuoxin20021. ;1ongtailedtitsjustbelongtoagenusunderparidae.Intheclassi

    ;ficationsystemsofSibley&Ahlquistfl990)andSheldon&Gill ;(1996),longtailedtitsarelistedinanindependentfamilyof ;aegithalidaeunderSylvioidea.Spicereta1.(2004)studiedthe ;phylogeneticrelationshipsofSylvioideausing16SrRNAse

    ;quences.whoseresultssupportedtheopinionsofSibley& ;Ahlquistfl990)andSheldon&Gillf1996).Ourresultsalso ;supportedtheopinionthatlongtailedtitsshouldbeindependent




    ;andparids.Thismaybeaconsequenceoftherelativelysparse ;taxonsampinginthedataset.andmoreandmorescholarsem. ;phasizeddensenesssamplingandincreasingsamplequantity ;(Omlandeta1.1999;Rannalaeta1.1998).Thebootstraphum. ;bersoflongtailedtitsandsylvioideaclusterinphylogenetic ;treesconst

Report this document

For any questions or suggestions please email