DOC

Gold

By Alicia Henderson,2014-07-23 21:22
13 views 0
GoldGold,gold,GOLD

    Gold

May2008,Volume2,No.5(SerialNo.6)JournalofLifeSciences,ISSN1934?7391,USA

    ;Goldnanoparticle-basedanodicstrippingvoltammetry ;detectionoftranscriptionfactorNFKB

    ;J?Qin.HENong-yue,LUZuhong

    ;(StateKeyLaboratoryofBioelectronies,SoutheastUniversity,Nanjing21009&Chi

    naJ

    ;Abstract:TranscriptionfactorandsequencespecificDNA ;interactionsplayimportantrolesindruggenomeand ;transcriptiondiagnosis.Goldnanoparticlesshowhigh ;sensitivity,stabilityandcompatibilityforbiologicalmolecules ;aselectrochemicalintercalators.Hereunimolecularhairpin ;oligonucleotideswereself-assembledontoAuelectrodesurface ;andelongationonsolidphasewascarriedouttodoublestrand ;oligonucleotideswithtranscriptionfactorNFvd3bindingsite.

    ;GoldnanoparticlecatalyzedAgdepositionwasdetectedby

    ;anodicstrippingvoltammetry(ASV)forNFvd3binding.Itwas

    ;indicatedthatthismethodforsequencespecificDNAbinding ;proteindetectionshowspronouncedspecificity,sensitivityand ;wecanfindapplicationintranscriptionregulationresearch, ;openreadingframecharacterizationandfunctionalgene ;inspectionbythismethod.

    ;Keywords:transcriptionfactor;NFKB:unimolecularhairpin

    ;OligonucleOtide;anodicstrippingvoltammetry;gold ;nanoparticle

    ;1.Introduction

    ;ManyproteinswithnaturalspecificDNAbinding

    ;activityareinvolvedinregulatingcellularprocesses ;suchastranscriptionl?

    ;,

    ;recombination

    ;,

    ;restriction[3

    ;,

    ;andreplicationI.

    ;Theseincludetranscriptionfactors

    ;whichmaybecentraltothedrugdevelopment,disease ;pathogenesisandtranscriptiontherapyRecently, ;thereareseveralreportstouseelectrochemical

    ;approachtodetectiontheDNAbindingproteinsonthe

    ;electrodesurface.Barton.etalreportedto ;immobilizedoublestrandDNAonthesurfaceofAu ;electrodewithdaunomycinasintercalatortoinspect ;„Acknowledgements:Thisresearchisfinanciallysupportedby

    ;theNationalNaturalScienceFoundation(No.90606027; ;60501010.

    ),Ph.D.;researchfield:biomedical ;PANQin(1973

    ;engineering.

    ;theinteractionbetweenDNAandmethyltransferase ;M.HhaI,UracilDNAglycosylaseandrestriction

    ;endonucleasePvuH.JIN.etal7investigatedkinetics

    ;andspecificityofEcoR1withgoldnanoparticlelabeled ;ferroceneasindicator.Recently,goldnanoparticles ;haveattractedmuchattentiont8-]01especiallvas ;electrochemicaltag1-withbiocompatibility.

    ;sensitivityandstability.CAI.etall4linvestigated

    ;differentialpulsevoltammetrysignalsfor ;hybridizationwithgoldnanoparticlelabeledprobes. ;NIE.etal【】reportedhybridizationwithgold

    ;nanoparticlelabeledprobesbyLayer--by--Layer ;approach;ElectrochemicalsignalofAunanoparticle ;labelwasimproved100magnitudeswhenamplifiedby ;silverenhancementl6-.Thereisnoreportaboutthe

    ;detectionofinteractionbetweentranscriptionfactors ;andspecificDNAsitesbyelectrochemicalsignalof ;goldnanoparticlecatalyzedAgdeposition.

    ;NFKBisafamilyoftranscriptionfactorsthat ;regulatesawidevarietyofbiologicalprocessessuchas ;inflammation,apoptosis,cellcyclecontrol,andcell ;migration[2~-”.TheinteractionbetweenNF—KBand

    ;specificbasepairsindomainofthesequencespecific ;DNAwasduetohydrogenbond,hydrophilic

    ;interactionandVanDerWaalsForcealongwith ;specificstructuresofNFKBbindingsites.The

    ;methodstodetectNFKBincludex-ray

    ;crystallography_.electrophoresismobilityshift ;assayI27-l291.fluorescencepolarizationDNAbinding ;experiments[30andmicroarray[3?.Asfarasweknow, ;thereisnoreportaboutelectrochemicalsignal ;detectionofNF_KB.

    ;51

    ;Goldnanoparticle-basedanodicstrippingvoltammetrydetectionoftranscriptionfactorN

    F.KB

    ;Herewepresentanewelectrochemistrybased

;methodt0inspectsequencespecificDNAbinding

    ;transcriptionfactorNF.KB.Unimolecularhairpin ;0ligOnucle0tideswereself-assembledontoAu ;electrodesurfaceandtheirelongationonAuelecode

    ;surfacewascarriedouttodoublestrand

    ;oligOnucleOtideswithtranscriptionfactorNI‟_KB

    ;bindingsites.GoldnanoparticlecatalyzedAg

    ;depositionwasdetectedbyanodicstripping ;voltammetry(ASV)forNF-KBbinding.Themethod ;showedhighsensitivity,specificityandsimplicity. ;2.Materialsandmethods

    ;2.1Agentsandinstruments

    ;Table1Unimolecularhairpinoligonucleotidesequence ;NameSequencea

    ;XYF

    ;C0NA

    ;CONB

    ;5‟…thiolgroup…~GAATTCGGGACTTTCCCAGGCTGCCTG一一3‟

    ;5‟…?thiolgroup…TIqTIWIWITGAATTCTITTCCGGCAGGCTGCCTG…3‟

    ;5‟一一Trrrr]11TGAATTCGGGACCCAGGCTGCCTG…3‟

    ;Note:BlackanditalicportionshowsrhNFKBp50hornodimerbindingsite. ;Thesequencesoftheunimolecularhairpin ;o1igonueotidesXYF,CONAandCONBwereshown ;inTable1andallofthemweresynthesizedby ;InvitrogenInc.(Shanghai.China).XYFismodifiedat ;5‟endwiththiolgroupandincludesNF—KBbinding

    ;site.CONAismodifiedat5‟endwiththiolgroupand

    ;doesnotincludeNF-KBbindingsite.CONBincludes ;NF.KBp50homodimerbindingsitewithoutthiol ;groupmodificationat5‟end.NF—KBp50.streptavidin

    ;labeledwithgoldnanoparticleandbiotinlabeleddUTP ;wereobtainedfromSigmaInc.Electrochemica1 ;measurementwascarriedoutonaCHI660

    ;workstationfromChenhuaInc.(Shanghai,China).The ;threecompartmentelectrochemicalcellconsistedof ;anAuelectrodewithdiameterof2mmastheworking ;electrode.asaturatedcalomeIelectrodeasthe ;referenceelectrodeandaplatinumelectrodeasthe ;auxiliaryelectrode(ChenhuaInc.,Shanghai). ;2.2Methods

    ;2I2.1SinglestrandDNAself-assemblyonAu ;electrode

    ;Theelectrodeswerepretreatedandevaluated ;accordingtoH0U.etal.Thiolgrouplabeled

    ;unimolecularhairpinOlig0nucleOtidesolutionwas ;denaturedbeforeself-assembly.ThepretreatedAu ;electrodeswereimmersedinthiolgroup1abeled ;52

    ;unimolecularhairpinoligonucleotidesfloracertain ;periodoftime.

    ;2.2.2Blockingonelectrode

    ;Afterself-assemblingtheelectrodeswereblocked ;with1M3-Mercaptoethanol(MCE)solution/1wt%

    ;BSAsolution,1MI~-Mercaptoethanol(MCE)solution ;and1wt%BSAsolution.respectively.

    ;2.2.3Elongationanddetectionofunimolecular ;hairpinOligOnucleOtidesOnelectrode.

    ;Unimolecularhairpinelongationwascarriedout ;inthreepolymerizationsolutionsofSolutionAand ;SolutionB.SolutionAcomposedof40mMdATP.40 ;mMdCTP,40mMdGTP,40mMd1vrP,0.1

    dUTP,50mMTris-HCl(pH7.2),0mM ;biotin

    ;MgSO4,0.1mMDTT,20ug/mlacetylatedBSAand ;0.05U/IJLTaqenzyme(ShengxingInc.,China)at37 ;.Cf0r120min.SolutionBincludedallthecomponents ;inSolutionAexceptforbiotindUTP.SolutionC

    ;includedallthecomponentsinSolutionAexceptfor ;Taqenzyme.Unimolecularhairpinoligonucleotide ;XYFwaselongatedinthethreesolutionsrespectively ;andunimlecularhairpinoligonucleotideCONBwas ;elongatedinSolutionA.Afterelongationthe ;electrodeswereimmersedingoldnanoparticlelabeled ;streptavidinsolutionandthereactionwascarriedout ;f0r45minutesat37.C.Thenelectrodeswereaddedto ;Agsolutionf0.01MAgNOfl0.O1Mhydroquinone)for ;

    ;Go

    ;ldn

    ;an

    ;

    ;oparticle?basedanodicstrippingvoltammetrydetectionoftranscriptionfactorNF?r.B

    ;10minutesandAgoxidationcurrentsignalswere ;detectedbyASVat0.0981.3Vin0.1MHNO3/0.1M

    ;KNO3electrolyte.

    ;2.2.4GoldnanoparticlebindingtoproteinandAg ;enhancement

    ;Goldnanoparticleswerepreparedwithdiameter ;of13nmI”J.

;Before0.2MK2COwasusedtoa0just

    ;thepHvalueofthegoldnanoparticlesolutionto8.2. ;TheelectrodeswereimmersedintoAunanoparticle ;solutionfor60minutesat37.CAftertheelectrodes ;wereimmersedin0.01MAgNO3[0.01M

    ;hydroquinonefor10minutes,Agoxidationcurrent

    1-3Vin0.1M ;signalweredetectedbyASVat0.098

    ;HNO3/0.1MKNO3electrolyte.

    ;2-2.5NFr,BbindingsequencespecificDNA

    ;NFr,Bdilutedinproteinbindingbufferf10mM ;HEPES,5OmMKCl,2.5mMDTT,0.1mMEDTA,

    ;0.05%NP40.10%glyceroland5%BSA)was

    ;incubatedwiththeproteinbindingbufferincluding ;NF..r,Bfor60minutesat37.C.

    ;3.Resultsanddiscussion

    ;3.1Designofunimolecularhairpin

    ;oljgonucleotjde

    -?1——‟ ;ene?.‟k-nl.ly.ef

    ;?

    ;te”e‟?_‟kmeI-.eqe2

    ;NKBhhdi|.-

    ;-hT..-

    ;0=Fig.1Principleofunimolecularhairpin ;oligonucleotideextension

    ;Fig.1showedprincipleofunimolecularhairpin ;Olig0nucleOtideextension.Thetworecverse ;complementarysequencesoftheunimolecularhairpin ;OligonucleOtideformpartialhairpinafterannealingand ;the3‟endwaselongatedbyTaqenzyme.That

    ;approachshowedhighspecificityforthereasonthat ;lowmismatchwasobtainedfromTaqenzyme ;catalyzationandhigherspecificitythanheterogeneous ;hybridizationalongwithhighstabilityofunimolecular ;hairpinintheoligonucleotides.

    ;3.2Detectionofunimolecularhaipin

    ;Oligonucle0tideelongationonAuelectrode ;Illl6

    ;l5

    ;{?

    ;n{

    ;J112

    ;n0l

    ;q0(,

    ;022502255fl2

;?aLMicpolcnli~dlV‟

    ;Figure2

    ;Fig.2ASVforstreptavidinlabeledgold

    ;nanoparticle-catalyzedAgdepositiontoverificationof ;singlestrandoligonudeotideextension

    ;Notes:Curve(a)correspondstosinglestrand ;Oli2onuc1eOtideXYFextensionwithbiotin1abeleddUTP ;incorporation;Curvefb1correspondstosinglestrand ;oligonucleotideXYFextensionwithoutbiotinlabeleddUTP ;incorporation;Curve(c)correspondstosinglestrand ;OligOnucleOtideXYFextensionwithoutTaqcatalyzation; ;Curvefd1correspondstotheextensionofsinglestrand ;OligOnucleOtidewithoutthiolgroupmodificationat5‟endwith

    ;biotinIabeleddUTPincorporation;Curve(e)correspondsto ;PBS(withoutsinglestrandoligonucleotides,incubationwith ;Auelectrodes.

    ;Incurve(a)1mmobilizedunimolecularhairpin ;01ig0nuc1eOtidesXYFwasextendedtodoublestrand ;o1igOnucleOtideswithbiotinlabeleddUTP

    ;incorporation.Biotinspecificallyboundtostreptavidin ;sostreptavidinlabeledgoldnanoparticleswere ;attachedonAuelectrodes.Goldnanoparticles ;catalyzedAgreducedtometallicAgthatdepositedon ;thesurfaceofgoldnanoparticles,whichcatalyzed ;moreAgreductionanddeposition.Atoxidation ;potentialof0.27VmetallicAgoxidationpeakcurrent ;signalwasobserved.Incurve(b)metallicAgoxidation ;peakcurrentsignaldidnotappear,whichprovedAg ;53

    ;Goldnanoparticle-basedanodicstrippingvoltammetrydetectionoftranscrip.Ict1:

    ;oxidationpeakcurrentsignalfromsinglestrand ;extensionhadnothingtodowithunspecificabsorbance ;ofstreptavidinlabeledgoldnanoparticles.Curve(c) ;indicatedunimolecularhairpinoligonucleotidesself ;

    ;assembledonAuelectrodeshowedlowunspecific ;bindingbackgroundwithstreptavidinlabeledgold ;nanoparticlecatalyzedAgdeposition.Curve(d)

    ;showedunimolecularhairpinoligonucleotides ;producedlowsignalbackground.Curve(e)showed ;self-assembledsolutionledtolowsignalbackground. ;Theseresultsindicatedthemethodforsinglestrand ;extensiononAuelectrodeshowedhighspecificity. ;3.3Interactionbetweenproteinandsequce

;specificDNA

    ;Anodlcenb?{V}

    ;Figure3

    ;Fig.3ASVofgoldnanoparticle.catalyzedAgdeposition ;fordoublestrandollgonucleotidesbindingNF-ldBdetection ;Notes:Curvera)correspondstojncubationofdotIb/e ;strandOligOnucleOtidewithoutNFrd3bindingsitewith0.1pM

    ;NFrd3;Curve(b)correspondstodoublestrandolig0nucleotide ;fromXYFincubationwith0.1pMNFKB;Curve(c)

    ;correspondstodoublestrandoligonucleotidefromXYF ;incubationwith0.1uMBSA;Curve(d)correspondstosingle ;strandoIigonucleotideXYFextensionwithoutTaqenzyme ;followingwith0.1pMNFrd3incubation.TheanDwshowed ;peakcurrentfromAgdeposition.1]heinsetshowsdifferent ;concentrationNFKBdetectedbyASVofgold

    ;nanoparticlecat~yzedAgdeposition.

    ;Thespecificityandsensitivityofinteraction ;betweenNF-r._BandDNAwereinvestigatedandthe ;resultwasshowninFig.3.Curve(b)showed

    ;unimolecularoligonucleotideXYFwasextendedwith ;NF-r.Bp50homodimerspecificbindingsite

    ;GGGACT1‟I?C.NF-rd3wasboundtodoublestrand

    ;oligonucleotidesandthiolgroupofNF--formedAuS

    ;covalentbondwithgoldnanoparticles.AucatalyzedAg ;depositiononAusurfaceat0.27Vpotentia1.Curve(a) ;didnotpresentAgoxidationpeakcurrentsignalsforthe ;reasonthatdoublestrandoligonucleotidesdidnot ;includeNF‟specificbindingsite.whichindicated

    ;NF-rO3p50homodimerrecognizedsequencespecific ;DNA.BSAdidnotbindanyDNAsequencessochive(c) ;didnotpresentAgoxidationpeal(currentsignals,which ;indicatedtheelongateddoublestrandoligonucleotides ;didnotbindsequenceunspecificprotein.Thespecificity ;ofNF-nBbindingsiteshowedhighlighttoinvestigate ;affinitybetweenDNAsequenceswithvariablebases ;andacertainkindoftranscriptionfactorwhichledto ;bindingsitedetection.

    ;ff}S

    ;Il{)7

    ;0/)6

    ;i?5

    ;0

    ;‟Hu

    ;003

;0.02

    ;Il1

    ;tions.Curve(a),(b),(c),(d),(e)and(f)represent ;

    ;ldnanopartidebasedanodicstrippingvoltammetrydetectionoftranscriptionfactorNF-

    KB

    ;ASVcurvewithNFr,Bconcentrationof12.452ng/L,25.937 ;ng/L,37.525ng/L,50.632”g/L,63.328ng/Land1.2452ng/L,

    ;respectively.BshowsAgoxidationpeakcurrentdataat5 ;diflferentNF-l(Bconcentrations.

    ;Fig.4showedASVcurvesofthreedifferent

    ;concentrationsofNF-1(B.Linearresponsewas ;observedintheNF_lcBconcentrationrangefrom ;12.452to63.32ng/L.Thedetectionlimitwasaslowas ;1.2452ng/Lr0.1pM).Thedetectionlowlimitwas0.1 ;PM,whichwasthreemagnitudelowerthancommon ;fluorescencemethodforDNAproteininteractionI.

    ;4.Conclusions

    ;Hereself-assembliedunimolecularhairpin ;O1igonucleOtjdeswereelongatedtodoublestrand ;Olig0nucleOtidesonAuelectrodesandboundproteins ;wereinspectedbygoldnanoparticlecatalyzedAg

    ;depositionASVsignalswithpronouncedspecificity ;andsensitivity.Themethodgavehighlightfor

    ;transcriptionregulationnetwork,operatorsite ;recognitionandfunctionalgeneinspection. ;References

    ;n1C.0.Pabo,R.T.Sauer.Transcriptionfactors:Structural ;familiesandprinciplesofDNArecognition.Annu.Rev. ;iochem.1992.61:10531095.

    ;f2N.L.Craig.Themechanismofconservativesitespecific

    ;recombination.Annu.Rev.Genet.1988.22:77105.

    ;3A.Pingoud,A.Jeltsch.RecognitionandcleavageofDNA ;bytypeIIrestrictionendOnucleases.Eur.Biochem. ;1997.246:122.

    ;4C.Margulies,J.M.Kaguni.Orderedandsequential ;bindingofDNAproteintooriC.thechromosomalorigin ;ofEscherichiacoli.‟,.Bio1.Chem.1996271:

    ;17035.17040.

    ;[5P.P.Pandolfi.Transcriptiontherapyforcancer.Oncogene, ;2001.20:31163127.

    ;f6E.M.Boon,J.E.Salas,J.K.Banon.Anelectricalprobe ;ofprotein.DNAinteractionsonDNAmodifiedsurfaces.

    ;Nnt.Biotechno1.2002.20:282286.

;7J1NY.,LUW.,HUJ.,YAOX.,LIJ.SitespecificDNA

    ;cleavageofEcoRlendonucleaseprobedby

    ;electrochemicalanalysisusingferrocenecappedgold ;nanopa~iclesasreporter.Ectrochem.Commun.2007.9: ;10861O90.

    ;8C.Ban,S.Chung,D.S.Y.Park,B.Shim.Detectionof ;proteinDNAinteractionwithaDNAprobe:Distinction

    strandanddoublestrandDNAprotein ;betweensingle

    ;interaction.NucleicAcidsRes,20O4,32(13):e110. ;9T.A.Taton,C.A.Mir~n,R.L.Letsinger.Scanometric ;DNAArrayDetectionwithnanoparticleprobes.Science, ;20o0.289:17571760.

    ;10DUANX.R.,LIZh.P.,CUIP.J.,SUY.Q.Studyon ;self-assemblyofgoldnanoparticlesdirectedby ;glutathionewithresonancelightscatteringtechniqueand ;itsanalyticalapplications.I,.Nanosci.Nanotechnol,2006, ;6:3842.3848.

    ;11NIEL.,YANGY.,LlS.,wANGJ.,andH0UQ.QCM ;detectionofoligonucle0tidebyquiescentmodeand ;flowingmode.Nanosci.Nanotechno1.2007.7: ;29272929.

    ;12WANGJ.,XUD.,A.N.Kawde,R.Polsky.Metal ;nanoparticlebasedelectrochemicalstripping

    ;potentiometricdetectionofDNAhybridization.Ana1. ;Chem.2001.77:55765581.

    ;13L.Authier,C.Grossiord,P.Brossier,B.Limoges.Gold ;nanoparticlesbasedquantitativeelectrochemicaldetection ;ofamplifiedhumancytomegalovirusDNAusing ;disposablemicrobandelectrodes.Ana1.Chem.2001.7:

    ;445O4456.

    ;141M.Ozsoz,A.Erdem,K.Kerman,D.Ozkan,B.Tugrul,N. ;Topcuoglu,H.Ekren,M.Talyan.Electrochemical ;genosensorbasedOrlcolloidalgoldnanoparticlesforthe ;detectionoffactorVLeidenmutationusingdisposable ;pencilgraphiteelectrodes.Ana1.Chem,2003,75: ;21812187.

    ;15CAlH.,FANGY.,HEP.Studiesonallelectrochemical ;dnabiosensorbasedongoldnanoparticlelabeledDNA

    ;probe.Chem..,.CheseUniversities.2003.24: ;13901394.

    ;16]NIEL.B.,HEQ.G.,

    ;electrochemicaldetection

    ;CHENJ..eta1.Enhanced

    ;ofDNAhybridizationwith

;carbonnanotubemodifiedpasteelectrode.J.Nan

Report this document

For any questions or suggestions please email
cust-service@docsford.com