DOC

Dynamic_0

By Glen Diaz,2014-07-23 14:07
13 views 0
Dynamic_0Dynami

    Dynamic

May2008,Volume2,No.5(SerialNo.6)JournalofLifeSciences,ISSN1934-7391,USA

    ;Dynamicchangeofxylanaseactivityandgeneexpressionduring ;wheatgerminationonAs(1iDstress

    ;LIChun-xi,LIDandan,SHAOYun,FENGShuli,ZHANGDaijing,ZHANGBeib

    ei,JIANGLi.na

    ;(CollegeeSciences,HenanNormalUniversity,XinxiangHenan45300ZChina) ;Abstract:Throughwatercultivatingmethod,thedynamic ;changesofxylanaseactivityinseed,rootandplumuleofwheat ;withdifferentAs(1idconcentrationtreatmentwerestudied.The ;resultsindicatedthattheorderofaveragexylanaseactivitywas ;seed>plumule>root.WiththeincreasingconcentrationofAs ;(III),thexylanaseactivityelevatedfirstthendroppedinseed, ;butitdescendedfirstthenascendedinrootandplumule.Asthe ;samplingtimeprolonged,thexylanaseactivityofseedsclimbed ;firstthendroppedonthefouras(III)concentration,thesame ;trendalsoappearedinpulume,astheas(III)concentrationwent ;up,thexylanaseactivitymovedupsimultaneity.Semi’quantity

    ;ReverseTranscriptionPolymeraseChainReactionwasusedin ;thestudy,theresultsindicatedthat,thexylanasegenebeganto ;expressat132hon0mAs(III)concentrationandat120hon ;otherconcentrationinthe1eavesofwheat.

    ;Keywords:As(1iDstress;wheatxylanase;xylanasegene;actin ;gene;semi?quantityreversetranscriptionpolymerasechain ;reaction

    ;1.Introduction

    ;Arsenic,anaturallyoccurringelement,is

    ;ubiquitousintheearth’scrustandwidelydistributedin

    ;soilaswellaswatersystemsasacontaminant.Asthe ;productionscontainsarsenicwastedisperseinto

    ;environmentwithoutprocessing,theecological

    ;problemisseriousdaybyday.Cropsarepoisonedo13 ;arsenicstresswiththeactivityofcatalase(CT),

    ;superoxidedismutase(SOD)dropsandthecontentof ;MDAascends….whichleadstothestructureofcell

    ;‘Acknowledgments:TheauthorwillthanktoWANG

    ;LinsongfHenanNormalUniversity)fortechnicalassistance ;andCHANGZhong~ieforphotographicwork.Thisresearch ;wassupportedbytheOutstandingYouthFoundationofHenan ;ProvincerNo.0412000l700).

    ;LIChunxif19641.male,professor;researchfield:wheat ;physiologyandecology.

    ;protoplasmicmembranedestructedanditsrelative ;penetrabilityincreasedsimultaneously.Dubey,etal ;discoversthatduringricegermination,arseniccause ;theactivityofalphaamylase,beta-amylase,sucrose

    ;phosphorylase,sucrosesynthetase,acidicinvertaseand ;starchphosphorylasedescends,whichmakesthe ;carbOnmetabolismofricedisordered.Germinationis ;thebeginningofplantlifecycleaswellastheinitial ;stageofplantsensatedexternalenvironment,during ;whichthemetabolismbecomesactiveandaseriesof ;enzymeactivitysuchasproteinasesandhydrolytase ;graduallystrengthens.Itissignificanttostudythe ;changingrulesandmolecularmechanismofheavy ;metalstressOilplantsfortheresearchofinjury ;mechanismandtheexplorationofpreventingand ;controllingmethods.Atpresent,thestudiesofarsenic ;arefocusedoffgermination,lipidperoxidation, ;developmentandtheoutputofplants,justatthe ;primarystage.Reportsonsomeimportant

    ;physiologicalstudieshavenotreferto.Researches ;abouttheeffectsofarsenicstressonanimalsfromthe ;molecularlevelareprevalentI3.buttheyarefewestin

    ;plantsatpresent.

    ;Xylanisoneofthewidelyexistenthemicellulose, ;whichcanbefoundmainlyinsecondarywallsofplants ;andcanrepresentupto35%ofthetotaldryweightin ;certaincereals5J.Xylanisacomplexpolysaccharide ;consistingofabackboneof3-D1,4-linked

    ;xylopyranosideunitssubstitutedwithacetyl, ;glucuronosyl,andarabinosylsidechainslo.High ;glutinosityofxylan,whichrestrictstheapplicationof ;gramineousplantssuchaswheat,rye,barley,etalin ;45

    ;Dynamicchangeofxylanaseactivityandgeneexpressionduringwheatgerminationonas(i

    l1)stress

    ;feedandfarmingindustry,wasnamedasan

    ;AntinutritionFactorI71.Xylanase(EC3.2.1.8,isa ;seriesofenzymethatcanhydrolysethe1,4linked

    ;[3-Dxylopyranosylbackboneofxylan.Atpresent,there ;ismuchstudyofxylanasethatcomesfrombacterium ;andfungi8_9,however,thereisnoreportonthe

    ;xylanasethatobtainsfromplants.Chrispeelshasfound

    ;thatthexylanaseactivityofbarleycontinuedto ;increasewhentheactivityofhydrolasesuchasamylase ;begantodeclineI10-11.Itwasconsistentwiththe

    ;reporteddelayinthesecretion/releaseof ;endoxylanasesincomparisonto~-glucanase ;(Banik)l2J.Inaddition,duringgermination,the ;aleuronetissuesecreteshydrolyticenzymesintothe ;endospermstoragetissuethatbringaboutthe ;degradationofstoredstarchtoprovideasupplyof ;nutrientsforthegrowingembryo.Oncecompleting ;theirexcretionthealeuroneadopsisedimmediately, ;Caspershasreportedthatacytoplasmicendop1,

    ;4xylanaseplayedanimportantroleinthealeurone ;ProgrammedCellDeath.BethkerevealedthatGA3 ;promotedthereleaseofhydrolaseinaleurone,leading ;tothePCD,whereas,ABAresistedtotheeffectofGA3 ;andrestrainedtheexcretionofhydrolase.ZHOU ;Jianming,etalconsideredthatdrought,highsaltand ;diseasemadetheexpressionofdilgene,WESRgene, ;13-1,3glucanasegeneenchenced.Therefore,we ;decidedtoresearchtheendo3-1,4xylanaseactivityin

    ;germinatingwheatgrainonAs(III)stress,andtostudy ;thedynamicchangeofitsgeneexpressionwiththe ;semiQRTPCR,thenwecaninvestigatetheruleof ;xylanaseplayedinthegerminatingwheatgrain,which ;canbeusedtoreasoningthemolecularmechanismof ;synthesisanddegradationofxylaninplantsonheavy ;menta1stress.

    ;2.Materialsandmethods

    ;Plantmateria1.TriticumaestivumL.Zhengzhou ;9023.

    ;Experimentdesign.Maturegrainsofwheat

    ;(TriticumaesKvumL.Zhengzhou9023)were

    ;surfacesterilizedfor6minwith0.1%HgC12.rinsedwith ;distilledwaterandgerminatedinsterilePetri.100grains ;eachdishes.Germinatinggrainswerecultivatedat ;18?2?.6000Lxandahumidityof75?7%in

    ;HPIOOOGSBArtificialIntelligentizedPaintClimate ;Case,supplementedwithAs(?I)onfourconcentration0,

    ;0.1,5,25mg/L(eachconcentrationhas3repetitions). ;Individualplantswerecontinuouscollectedafter ;germinating48hat12hintervals.andthetissueswere ;separatedintoseeds,rootsandplumulestoassayxylanase ;activities.TheplumulesforRNAextractionwere

    ;preparedaftergerminating96h,thesamplingmethod ;wassametotheformer.Usingthemethodof ;Semi-QuantityPolymeraseChainReactiontostudythe ;dynamicchangeofxylanasegeneexpression. ;Enzymeassays.Xylanaseactivitywasassayedby ;adding1mlofenzymesourcewithtrituratedextraction ;to20mgBeechxylan(Sigma)in2mlof50mmol/L

     ;sodiumacetatebuflfer(pH5-3)andincubatedat50?

    ;for5min,thentheamountofreducingsugarsinthe ;reactionmixturewasdeterminedusingdinitrosalicylic ;acid(DNS)reagentandxyloseasastandard.Oneunit ;ofxylanaseisdefinedastheamountofenzymethat ;liberates1gmolofxyloseequivalentsperminuteunder ;theassayconditions[?.

    ;Xylanasegeneexpression.TotalcellularRNA ;fromwheatleaveswerepreparedwithTRNzOl ;(TIANGEN),OD26oandOD2soweremensuratedto ;confirmthequantityofRNA,andtheintegralityof ;RNAwastestedwithelectrophoresison1%agarose; ;FirststrandcDNAsynthesis:cDNAwassynthesized ;withMMLVFirststrandcDNAsynthesiskit(Sangon). ;PCRamplification:PrimersActinF

    ;(GTTCCAATCTATGAGGGATACACGC)and

    ;ActinR(GAACCTCCACTGAGAACAACATrACC)

    ;werederivedfromthewheatActinsequencepublished ;bvZHANGli-na,etalI20J.(GenBankaccession ;48927617)PrimersXYN-F

    ;(CGAGAACGAGATGAAGTGGT)andXYN.R

    ;.

    ;D

    ;.....

    ;y....

    ;n

    ;....

    ;a

    ;....

    ;m

    ;......

    ;i

    ;..

    ;c

    ;......

    ;c

    ;...

;h

    ;.... ;a

    ;.... ;n

    ;.... ;g.... ;e

    ;..... ;o

    ;.... ;f.... ;x

    ;...

    ;y..

    ;1

    ;..

    ;a

    ;.... ;n

    ;.... ;a

    ;...

    ;s

    ;——

    ;e

    ;——.. ;a

    ;.... ;c

    ;...

    ;t

    ;.

    ;i

    ;v

    ;

    ;it

    ;y

    ;andg—— ;eneexpressionduringwheatgerminationonas(iii)stress

    ;(GTG(CT)TGAG(GA)GAAGG(CG)(TC)ACG)

    ;weredesignedfromthewheatandriceB1,

    ;4endoxylanasesequence.BothDNAwasamplifiedin

    ;50lreactionmixtures(O.2mlVlofeachprimer,

;10xreactionbuffer,1.5mMMg,80gMdNTP.4

    ;glcDNA.1UTaqDNApolymerase).PCRreactions ;weresubjectedtoapreliminarydenaturationstepof5 ;minat95?,followedbv30cyclesoflminat94?,

    ;1minat57~C(Actingene.theTmofxylanasegenewas ;54?and1rainat72?onaTC25/Hthermoblock

    ;geneamplificationapparatus(BIOER,HangZhou). ;3.Results

    ;As(III)stressonxylanaseactivityduringwheat ;germination.AsshowninFig.1,Theactivityof ;xylanaseinthegrainwasmuchhigherthanthatof ;plumuleandroot,thedifferencebetweenthemis ;remarkable.Astheas(III)concentrationascended,the ;xylanaseactivityfirstrosethendroppedinseeds, ;however,itdescendedfirstlythenascendedinroots ;andplumules.

    ;Asthesamplingtimeprolonged.theactivityof ;xylanaseinseedsincreasedfirstthendecreasedonthe ;fourAs(III)concentration(Fig.2).Theenzyme ;activityof0mg/Land0.1mg/Lpeakedat60hand120 ;h,thetipof5mg/Lappearedat72hand120h,andit ;cameforthat72hand108hin25mg/LAs(IIbstress. ;Theaverageenzymeactivityof25mg/Lwas69.83% ;c00mgm.thedifferenceof25mg/Landtheotherswas ;prominent,whichrevealed25mg/LAs(III)hada ;stronglyinhibitiontoxylanaseactivityinseeds. ;Duringgermination,thexylanaseactivityofroots ;increasedfirstthendecreasedin0.1,5,25mg/LAs(III) ;concentration(Fig.3),andtheyallappearedpeaksat ;60h.Atthesametime,theenzymeactivityof0mg/L ;presentedadecreasingtrendduringthegermination. ;Theaverageenzymeactivityorderwas25mg/L>5 ;rag/L>0mg/L>0.1mg/L,theenzymeactivityof25 ;mg/Lwas1.02than0mg/L,thedifferenceof25meCL ;andtheotherswasnotable,whichrevealed25mg/LAs ;(III)hadastronglystimulativeeffectontheactivityof ;xylanaseinroots.

    ;00.1525

    ;As(Il1)concentration(mgL-)

    ;Fig.1As(HI)stressollxyressonxylanaseactivityofplumule ;Astimeprolonged,theactivityofxylanase ;increasedfirstthendecreasedalonginpulumeonthe ;fourAs(?I)concentration(Fig.4),Theorderofaverage ;enzymeactivitywas25rag/L>5mg/L>0mg/L>0.1

    ;mg/L,thesametoroots.theenzymeactivityof5mg/L ;was1.24than0mg/L,and25mg/Lwas1.35to0mg/L. ;bothofthemhadaremarkabledifferencewiththe0 ;mg/LAs(III)stress,whichindicatedthat,thexylanase ;activitywasmovingupastheAs(III)concentration ;wentup.

    I)sffessontheexpressionofxylanasegene ;As(?

    ;inleavesduringwheatgermination.Thedynamic ;changeofxylanasegeneexpressionwasanalyzedby ;themethodofsemiquantityThexylanasegenebegan ;toexpressat132hon0mg/LAs(III)stressinwheat ;leaves,butitsexpressionphasewasshort,onlyinthe ;6th7thdays,fromthe8thdayofgermination,there ;wasnoexpression(Fig.5).Atthesametime,the ;xylanasegeneof0.1mg/LAs(I11)stresswas ;expressedfromthe5thday,andterminatedonthe7th ;day,itsexpressionphrasewasearlierthantheformer. ;andtheexpressionquantitywasfewerthanthe0mg/L ;As(III)stress(Fig.6).Thexylanasegenestartedto ;expressfromthe5thdaytothe7thdayin5mg/Land ;25mg/LAs(III)stress,theirexpressionquantityin5 ;mg/Land25mg/LAs(1ibconcentration,fromanother ;pointofview,theexpressionphaseswerelengthened ;inthetwoconcentrations,

    ;thisconclusionwas

    ;48

    ;coincidentwiththeresultsofxylanaseactivity,which ;weremorethanthe0and0.1mg/LAs(1II)

    ;concentration,notonlythatbuttheirexpressionphrase ;werelongerthantheformertwo(Fig.7,8).Amongthe ;fourconcentration,thequantityofxylanasegene ;expressionin25mgFLAs(III)stresswasthemost ;amongthem,whichindicatedthatthehigh

    ;concentrationofAs(III)hadastimulativeeffectonthe ;xylanasegeneexpression.

    ;Ain

    ;Xylana~

    ;250bp

    ;500bp

    ;750bp

    ;lp

    ;96lOgJ20I32l44168l80marker

    ;Time(h)

    ;Fig.5Dynamicchangeofwheatxylanasegene

;expressionon0mg/LAs(?)stress

    ;Actin

    ;Xylal~tse

    ;250hp

    ;500bp

    ;Ls.9_bolooo6

    ;p

    ;%JosI20l32l44l68ls0marker

    ;Time(h)

    ;Fig.6Dynamicchangeofwheatxylanasegene ;expressionon0.1meCLAs(11I)stress

    ;250bp

    ;soon

    ;750bp

    ;l(.R~thp

    ;marker96l08l20{32l44l681S(

    ;Actm

    ;Xv|mmse

    ;Time(h)

    ;Fig.7Dynamicchangeofwheatxylanasegene ;expressionon5mg/LAs(I11)stress

    ;Acti

    ;Xylana~

    ;250bn

    ;5;

    ;750bp

    ;10(R)bp

    ;96togl2t)l32144}688Omarker

    ;Tiellulosehydrolase.Ingerminatingcerealgrains, ;thealeuronetissuesecreteshydrolyticenzymesintothe ;endospermstoragetissuebringaboutthedegradation ;ofstoredstarch,proteinandresidualnucleicacids, ;providingasupplyofnutrientsforthegrowing ;embryo2l_.Inourexperiment.thexylanaseactivity ;hadarisingfirstthenfallingtrendinseeds.Theorder ;ofxylanaseactivitywasseed>pumule>rootindifferent ;tissues,becausethegrainisthesourceofnutrition ;duringtheinitialstageofgermination,therespiration ;andmetabolismareallactive,accordingtowhichthe ;enzymeactivityisflourishing.Thexylanaseactivityof ;25mg/LAs(III)concentrationwereevidentlyhigher ;thantheothers,whichcanbeapprovedonthe ;molecularleve1.ItwasfelundthatastheAsfIII) ;concentrationascended,theexpressionperiodof

    ;xylanasegenecameforthearlierandendedlaterinleaf, ;atthesametime,theexpressionquantityofgene ;enhancedastheAs(?I)concentrationincreased,which ;revealedthathighAs(III)concentrationhada ;stimulativeeffectonthexylanasegeneexpression. ;HowdoestheAs(III)operate?Itcouldbespeculated ;onthefollowingaspects.

    ;First,duringthegermination,theplant

    ;developmenthastoberegulatedbymanyenzymes, ;whichcanbeproducedbytwoways,thereleaseand ;activationofinherentonesandtherenewedly ;synthesizedones24.Perhapsthexylanaseinseeds

    ;belongstotheformer,onthehighconcentrationofAs ;(III)stress,therootsofwheatcan’tabsorbwell,which

    ;madetheactivityofhydrolaseplayingimportantroles ;intherespirationfalling25_.However.thexylanase

    ;ofrootsandpumulesattributedtothelatter,whose ;geneexpressionwasactivatedbyAs(III),therefore, ;theactivityofxylanasegoingupinrootsandleaves. ;Secondly,duringgermination,thealeuronetissue ;secreteshydrolyticenzymesintotheendosperm ;storagetissuethatbringaboutthedegradationofstored ;starchtoprovideflsupplyofnutrientsforthegrowing ;embryo,oncecompletingtheirexcretionthealeurone ;diedimmediately28.

    ;Analyzingthexylanasewhich

    ;comingfrombarley,wheatandcorn,wecanfindmany ;commongroundsofthem.First,theyareallclassified ;intofamily10ofglycosylhydrolases(GH10); ;Secondly,theyhavenosignalpeptides,corresponding ;towhichtheycouldn’tsecrettotheoutercellularspace

    ;unlessthecellcomesintoPCDandthecytoskeleton ;wasbrokenup;Finally,thepeptidesthatinitially ;translatedfrommRNAare64KD(inaleurone)and60 ;KD(inpollen),havingnoenzymeactivity,asthecell ;comesintoPCD,theNterminalandCterminalare ;hydrolyzedmanytimes.Intheend,a35KDprotein ;whichhadxylanaseactivitywasformedI2930..Caspers

    ;identifiedthatancytoplasmicendoB-1,4xylanase

    ;playsanimportantroleinthealeuronePCD?.High

    ;concentrationofAs(III1waslikelytoactasacellular ;signalthatinducedtheProgrammedCellDeath, ;accordinglythexylanasegeneexpressedexcessively ;andthexylanaseactivityelevated.Furtherresearchis

    ;underwaytoelucidatethespecificphysiologicalroleof ;As(III)onthewheaendo-1,4.xylanaseinourlab.

    ;References:

    ;1ZHUY.J.,WANGC.Y.,MAY.X.,etaI.Effectof ;arsenicstressonthegrowthandmetabolismofthewheat ;rootsystem.ActaCTAEcologicAsinica,2000,20: ;707710.

    ;2JhaAB,DubeyRS.Carbohydratemetabolismingrowing ;riceseedlingsunderarsenictoxicity.JPlantPhysiol,2Oo4 ;16:867.872.

    ;3ZHANGY.D.,DeepakBhatia,XIAH.F.,eta1.Nucleolin ;linkstoarsenic.inducedstabilizationofGADD45aMrna. ;NucleicAcidsResearch,2006,34:485495.

    ;4HoracioO,Gonzalez,JonathanA,eta1.Physiological ;changesanddifferentialge

Report this document

For any questions or suggestions please email
cust-service@docsford.com