DOC

CD147

By Darlene Murray,2014-06-20 09:11
7 views 0
CD147

    CD147

    

    Mar.2007,

    

    Volume4,No.3(SerialNo.28)

    

    JournalofUS

    -

    ChinaMedi

    

    ca

    

    lScience,ISSN1548--6648,USA

    CD147FacilitatesCyclophilinA-inducedMMP.9Expressionon Monocytes/MacrophagesinRheumatoidArthritis

    YANGYong,ZHUPing

    (DepanmentofClinicalImmunology,XijingHospital,theFourthMilitaryMedicalUniversi

    ty,?,710032)

    Abstract:CyclophilinA(CyPA)isabundantinrheumatoidarthritis(RA)synovialfluidandC

    D147bighlv

    expressesOnthemonocytes/macrophagescellsinRAsynovialfluidandsynovium.Todeter

    minewhetherCypA

    canupregulatetheexpressionofmatrixmetalloproteinase2(MMP-2)andMMP.9inmonocy

    tes/macrophages

    andwhetherCD147facilitatesthisregulation

    ,humanmonocytecelllineTHP1cellswerestimulatedwithCypA. ThelevelsofMMP2andMMP-9mRNAwerequantifiedbyquantitativereal

timePCR(qRT-PCR),theDr0tein

    releaseanQactivationofMMPsweredetectedbygelatinzymographyandinvasionassay.TheresuItsshowedthat

    CYPAsignificantlyincreasedMMP9expression

    ,notMMP2,intheTHP1cells.CyclosporinA(CsA)or

    HAb18G/CD147antagonisticpeptideAP-9againstCD147respectivelydramatica11ydecreasedMMP.

    2and

    MMP9expression,bothintheabsenceorpresenceofCypA.

    SimilareffectofCypAonMMP.9Droductionwas

    oDervedmmonocytes/macrophagesderivedfromRApatien~'synovialfluid.ThesefindingssuggestthatCD147

    facilitatesCypA-inducedMMP-9expressioninmonocytes/macrophages ,whichmaycontributetothedestruction

    ofcartilageandboneinRA.

    Keywords:CypA;CD147;MMP;monocytes/macrophages:RA

    INTRODUCTIoN

    Rheumatoidarthritis(RA)isachronicdestructiveautoimmunedisease,andtheinitialhistologicalfeafuresof

    RAarecharacterizedbysynoviallininghyperplasia

    ,excessiveangiogenesisandtheaccuIImlatiOnOfIIl0nOnuc1ear

    cellsinthesynoviumMacrophageswhichsecretmatrixmetalloproteinase

    2(MMP2)andMMP.9areresident

    cellsandc0VerthesynoviallininglayerinnormaljointsThenumberofmacrophagessignificantlvincreases

    bot

    linthelmingandsubliningareasofRAsynoviumandtheincreasedegreecorrelateswiththeseveritv0f

    cartilagedestruction[31

CyclophilinA(CypA)ubiquitouslydistributedintracellularprotein,

    belongstotheimmunophilinfamily[41

    ,

    ssecretedbycellsinresponsetoinflammatorystimulationandisapotentneu~ophil ,eosinophilandmon0cVtes

    cnem0at

    actaJ1tmVorvivo-ItisabundantinRASF'butnotinSFfromOApatients[61.CD147,a1sonamed

    extracellularmatrixmetalloproteinaseinducer(EMMPRIN),isaregulatorofMMPproducti0nbvMAPK

    pathwayandservesasasignalingreceptorforextracellularcyclophilins181 .Researcheshaveshownt1atCD147

    expressononmonocytes/macr0phagesinRAsynoviumismuchhigherthanthatonmonocytes/macrophages

    denVedfr0mRApatient'speripheralbloodandthatCD147overexpressiononsynoviocytesinRAsynovium

    *Acknowledgement:ThisworkwassupportedbygrantsfromtheProject0fNationalHigh. techChiResearcharIdDevdopment0f

    na(863Program.30530720).……………P''

    zHuPing(1953-),female,Ph?D.,Ph.D.supervisor,

    .

    professorofDepartmentofClinicalImmunology,XijingHospital,meFoumlMilitaryMedicalUniversit

    y;researchfield:immunolocaJmediadoninrheuma0idarts.

    'uuu?

    55

    CD147FacilitatesCyclophilinA-inducedMMP-9ExpressiononMinRheumatoidArthritis enhancestheproductionofMMP2andMMP.9andtheinvasivenessofsynoviocytes

.Recently,

    thepotential

    roleofCypAandCD147,ligandandreceptor,insomeimmunologicaldiseaseshasbeenidentified,suchasAIDS

    andSevereAcuteRespira~rySyndrome(SARS),CypAintegrateswiththestructuralproteinonvirusand

    enhanceviralinfectiontothehostcellsbybindingtoCD147directly.'11].

    OurstudyreportedherewasdesignedtoinvestigatewhetherCypAcouldincreaseMMPsexpression,

    invasiveness,andwhetherCD147facilitatedCypA'sfunctions.Theresultsofthestudywebelievemayhelpusto

    gainabetterunderstandingofthepotentialroleofCypA

    CD147pathwayinRApathogenesis.

    I'A1'IENTSANDMETHODS

    1.RAPatients

    Samplesofsynovialfluidinkneejointsandperipheralbloodwereobtainedfromeightpatientswithactive

    RA.Allthesepatientsmetthe1987reviseddiagnosticcriteriaoftheAmericanCollegeofRheumatology.The

    meanageoftheRApatientswas45years(range28-66years)andthemeandiseasedurationwas5years.

    Samplesofnormalcontrolperipheralbloodweretakenfromeightnormalhumandonorvolunteers,whohadno

    significantageorsexdifferencescomparedwiththoseoftheRApatients.Theethicsapprovalwasgrantedfor

    thisstudyahdallthesubjectsprovidedtheirinformedconsent.?

    2.CeJIsIsolationandCulture

    THP

    Icells(ATCC,Manassas,VA,USA)wereculturedinRPMI1640mediumsupplementedwith10%

fetalbovineserum(FBS)(Gibco,GrandIsland,NY,USA)at37?

    inahumidifiedatmosphereof5%CO2.For

    theinductionofcelldifferentiation,THP.1cells(5x10sto10permL)wereculturedinRPMI1640senlm

    mediumwith100nMphorbol12myristate13acetate(PMA)(Sigma

    Aldrich,St.Louis,MOUSA)for48h.After

    incubation,thenonadherentcellswereremovedbyaspirationandtheadherentcellsweredifferentiatedto

    macrophages(dTHP1)andwashedwithRPMI16.40threetimes.TheTHP

    1cellsinRPMI1640withoutPMA

    stimulationwereusedascontrolcells(theundifferentiatedTHP1,uTHP1).'

    Fortheisolationofmonocytes/macrophagesfromhumans,each5mlofhumanperipheralbloodwas

    collectedfromnormalpeopleandRApatientsbyaddingheparinandcooleddownto2-8?.Fo

    rsynovialfluid,

    hyaluronidase(5U/mL)wasaddedtodigesthyaluronicacid.Thebloodsamplewasdilutedwithanequalvolume

    ofcoldphosphatebufferedsaline(PBS)immediatelyandmonocytes/macrophageswereisolatedbyDynabeadsR

    M-450CD14(DynalBiotechASA,Oslo,Norway)inaccordancewiththemanufacturer'sinstructions.The

    rosettedcellswereresuspendinRPMI1640growthculture.

    3.CypAStimulationtoMonocytes/Macrophages

    Each(3xl05)oftheTHP

    1cellsandmonocytes/macrophagederivedfromRApatientsSFwasplatedin 24

    wellplatesandculturedwith5001alofserum-freeRPMI1640.CellswerepretreatedrespectivelywithCsA

    (200ng/mL),HAb18G/CD147antagonistpeptideAP

    9(2001xg/mL),whoseaminoacidsequencewas

    YKLPGHHHHYRP(designedandproducedbyourlab)for24h,andthenwerestimulatedwithCypA

    (200ng/mL).After24hofCypAstimulation,thesupematantswerecollectedforgelatinzymography.Inthesame

    way,cellswithvarioustreatmentswerecollectedfortheexperimentsofqRTPCRofMMP

    2,9,CD147mRNA,

    andinvasionassay.

    4.qRT-PCR

    ThetotalRNAwasextractedfromthecellsbyTrizolRNAextractionl

    it(Invirtogen,California,USA).1lag

CD147FacilitatesCyclophilinA-inducedMMP-9ExpressionOilMonocytes,Maro塾垒

    !

    ofeachtota1RNAwasreverse

    transcribedusingTwoStepRNAPCRkit(Takara,Otsu,Japan).Inbrief,reverse transcriptionwasperformedat42~Cfor30min,95?for5min,and4?

    for10min.qRT-PCRwasperformed

    usingaCFD3120MiniOpticonDetector(BIORAD,California,USA)withthedouble

    strandedDNAspecific

    fluorophoreSybrGreenI(MolecularProbes,Leiden,Netherlands).PCRreactionscomprisedlplcDNA,3pl

    25mMMgC12,2pldNTPsO0mM),2.5pl10xSybrGreenIPCRbuffer,lplof5mMforwardandreverseprimer

    mix,0.5plTaqDNApolymerase.Cyclingparameterswere95~Cfor30s,55~Cfor30s,and72~Cforlmin.After

    qRT-PCR,tI1edatawereprocessedwithOpticonMonitorTMVersion3. 1,thequantityofCD147andMMPs

    mRNAwasfirstnormalizedbyGAPDHandthenresultswerecomparedwiththoseofthenormalnegative

controlofundifferentiatedTHP

    1cells.TheCD147'sprimers:sense5'-GAGTGAAGGCTGTGAAGTCG3'and

    antisense5'-AACTCACGAAGAACCTGCT-3'.TheGAPDH'sprimers:sense5'-TCATCAGCAATGCCTCCT3'

    andantisense5'-CATCACGCCACAGTTTCC3'.TheMMP2primers:sense:

    5'TTGACGGTAAGGACGGACTC3'andantisense5'

    ACTTGCAGTACTCCCCATCG3'.TheMMP9's

    primers:sense:5'-TTGACAGCGACAAGAAGTGG

    3'and5'-CCCTCAGTGAAGCGGTACAT3'.

    5.GelatinZymography

    GelatinzymographywasperformedfordetectionofMMPsactivityinconditionedmedium.Foranalysisof

    proteolyticcapacity,conditionedmediawerecollectedandcentrifugedtoremovecellulardebris.Eachsample

    supematant(20g1)wasmixedwithSDSsamplebufferwithoutreducingagentandwasfollowedbydetectionof

    gelatinolyticactivityandquantityintheconditionedmediabygelatinzymography.Inbrief,theconditioned

    mediumwasresolvedbySDSPAGEundernon

    reducingconditionsusing8%separatinggelcontaining0.1%

    gelatin.Thegelswerethenwashedtwicein2.5%(v/v)TritonX

    100for30minatroomtemperature(RT)to

    removeSDSandincubatedinreactionbuffer(50mmol/LTris,0.2mol/LNaC1,5mmol/LanhydrousCaCI2)for

    16hat37"Ctohydrolyzethecopolymerizedproteinsubstrateinazonearoundtheirelectrophorezedposition.

    Then,thegelsweresubsequentlystainedwith0.5%Comassieblue(R

    250)for4handdestainedwithbuffer

    consistingof20%methanol,10%aceticacidand70%distilledwaterfor30mintovisualizethesezonesof

    digestionaslightareasagainstthedarklystainedproteinbackground.Thezymographygelswerescannedand

    analyzedusingUSNationalInstitutesofHealthImage1.6software.

    6.InvasionAssay

    Theinvasionassaywasperformedusing24

    welltranswellsunits(Costar,CambrigdeNY,USA).Eachwell

    hadan8-pmporesizepolycarbonatefilterwhichwascoatedwithMatrigelMatrix(5pg/mL,BDPharmingen,San

    Diego,CA,USA)toformacontinuousthinlayer.AfterpretreatedrespectivelywithCsAorAP9,the

    undifferentiatedanddifferentiatedTHP

    1cells(3xlO)wereplatedonthesurfaceoftheMatrigelwithserum-free mediumandculturedfor24hunderCypAstimulationat37oCin5%C02incubator.Thecellsremaininginthe

    uppercompartmentwerecompletelyremovedbygentlyswabbing.Thenumberofcellsinvadingthroughthefilter

    intothelowercompartmentwasdeterminedusingcolorimetrichematoxylinandeosinstainassay.Thecellsthat

    invadedthroughthefilterintothelowersurfaceofthefilterinfivemicroscopicfieldsof200xmagnificationwere

    countedineachfilter.Triplicatesampleswereconductedandthedatawereexpressedastheaveragecellnumber

    of15fields.

    7.StatisticalAnalysis

    Allvalueswereexpressedasthemean?

    SD.StatisticalanalyseswereperformedwithStudent'st-testusing

    SPSSsoftwareandPvalueslessthan0.05wereconsideredsignificant.

    57

    CD147Fadli~tmCyclophilinA--inducedMMP?-9ExpressiononMonocytes/Macrophage

sinRheumatoidArthritis

    RESUIrS

    1.MME'SReleaseandActivationintheTHP-1CellswithCypAStimulation

    Gelatinzymography(Fig.1)showedthattheundifferentiatedTHP1cellsexpressedlittleproMMP2

    (72kDa)andproMMP9(94kDa).whileproMMP2andproMMP9synthesiswasincreasedindifferentiated THP1cells(P<O.05).TheincreaseandactivationofproMMF'9toMMF'9(83kDa)wereevidentin

    macrophages<O.05).CsAorAP9respectivelydecreasedthesecretionofproMMP2andproMMP9in

    undifferentiatedordifferentiated唧一

    1cells<O.05).UnderCypAstimulation,thesecretionandactivationof

    proMMP9andMMP9,notproMMP2,wereincreasedintheundifferentiatedanddifferentiatedTHP1cells (P<O.05),andCsAorAP9blockadedCypAinducedMMP9expression. uTHP.1dTHP.1

    

    ++一十一十一十一十

    一一

    十十一一一一十+一一

    一一一一

    +十一一一一十+

    pro-MMP-9(94kD

    MMP-9f83kDa)

    pro-MMP?2(72kDn1

    CyPA(2o0ng/mL)

    CsA(2o0ng/mL)

    AP-9(20oug/mL)

    lane:1--6,theundifferentiatedTHP-1(UTHP-1);7?l2,thedifferentiatedTHP?1(dTHP-1) Fig.1GdatinzymographyofMMP-2,-9

    TheundifferentiatedanddifferentiatedTHP-1cells(UTHP-1anddTl_

    P-1)werepretreatedrespectivelywithCsAor AP

    9(for24h)andthenwerestimulatedwithCypAfor24h.Thesupematantswerecollectedforge

    lzymography.Dataare

    expressedasmeans___SD(n=3).

    2.MME'.2..9mRNAExpressioninTHP-1CellswithCypAStimulation TheresultsofqRTPCR(Fig.2)showedthatafterPMAstimulation,MMP2andMMP

    9mRNAexpression

    indifferentiatedTHP

    lcellswerehigherthanthoseinundifferentiatedTHP..,cells(P<O.05).CypAincreased

    MMP9mRNAexpression,notMMP

    2,inbothundifferentiatedanddifferentiatedTHP1cells(P<O.05).CsAor AP9decreased?一2andM9expressioninundifferentiatedordifferentiatedTHP

    1cellsrespectively

    (P<O.05),bothintheabsenceorpresenceofCypA.TheseresultsofqRT

    PCRcoincidedwiththeresultsof

    gelatinzymography(Hg.11.

    58

CD147FacilitatesCyclophilinA.inducedMMP.9Ex

    p

    re

    

    s

    

    si

    o

Report this document

For any questions or suggestions please email
cust-service@docsford.com