DOC

immunofluorescent

By Alvin Sanchez,2014-02-06 11:11
12 views 0
immunofluorescent

E Michalak et al. Supplementary Material

    Supplementary Materials and Methods

    Real time qRT-PCR analysis primer sequences.

    qRTPCR was performed using the following forward and reverse primers (a kind gift from Drs DCS Huang and KJ Campbell)

    gene sense (5’ 3’) antisense (5’ 3’)

    a1 GTCATACTTGGATGACTTTCACGTG ATTCTCCTGTGTTATTCATTATGAATTCTG

    bad AGTATGTTCCAGATCCCAGAGTTTG CCTTGAAGGAACCCTCAAACTCATC

    bcl-2 TTATAAGCTGTCACAGAGGGGCTAC GAACTCAAAGAAGGCCACAATCCTC

    bcl-xl TGGAGTCAGTTTAGTGATGTCGAAG AGTTTACTCCATCCCGAAAGAGTTC

    bim GAGTTGTGACAAGTCAACACAAACC GAAGATAAAGCGTAACAGTTGTAAGATAACC

    mcl-1 GAGGAGGAAGAGGACGACCTATACC AGTTTCTGCTAATGGTTCGATGAAG

    puma ATGCCTGCCTCACCTTCATCT AGCACAGGATTCACAGTCTGGA

    noxa ACTGTGGTTCTGGCGCAGAT TTGAGCACACTCGTCCTTCAA

    c-myc CAAATCCTGTACCTCGTCCGATTC CTTCTTGCTCTTCTTCAGAGTCGC

Supplementary Figure Legends

    Supplementary Figure 1 Loss of Puma affects some B lymphoid cell subsets in the lymph nodes and spleen of E-myc mice. Total cellularity and cell subset composition of pre-neoplastic 5-6 week old mice of the indicated genotypes. (A) Numbers of pre-B, virgin and mature B cells in the lymph nodes (axillary, brachial, inguinal pairs) were determined by immunofluorescent staining with surface marker-specific monoclonal antibodies and flow cytometric analysis. Differences between E-myc transgenic and

    non-transgenic mice were significant for all puma genotypes for pre-B cells, as were

Michalak et al

    -/-comparisons of virgin B cells for wt vs E-myc/puma mice and for the decrease in

    +/- -/-mature B cells for wt vs E-myc/pumaand wt vs E-myc/puma mice (P < 0.005).

    For comparisons of E-myc transgenic mice of the different puma genotypes, all

    statistically significant differences are indicated. (B) Similar analysis of the spleen revealed differences between E-myc and non-transgenic mice of all puma genotypes

    (P < 0.005) for pre-B cells and mature B cells and for total cells and virgin B cells for

    -/-wt vs E-myc/puma mice. For comparisons of E-myc transgenic mice of the

    different puma genotypes, all statistically significant differences are shown. Values represent means ? SEM from 5-8 mice of each genotype. * P < 0.05, *** P < 0.005.

Supplementary Figure 2 Impact of Puma loss on survival of E-myc pro-B cells and

    +sIg B cells in culture. (A) Pro-B cells or (B) virgin/mature B cells sorted from the bone marrow of 5-6 week old healthy wt mice or E-myc mice of the indicated puma

    genotypes were cultured in simple medium (no cytokines) or treated with etoposide (1 g/mL) for the indicated times. For all experiments cell viability was determined by

    --FACS analysis as the percentage of Annexin VPI cells. Values represent means ? SD

    of cells from 3-6 mice of each genotype. No statistically significant differences were noted between transgenic genotypes. Similar results were obtained with virgin

    hilolohi(sIgMsIgD) and mature (sIgMsIgD) B cells from the spleen (data not shown).

Supplementary Figure 3 Representative immunophenotyping FACS plots of

    -/-lymphomas from E-myc and E-myc/puma mice. Cell suspensions were prepared

    from primary lymphomas and flow cytometric analyses performed after immunofluorescent staining with surface marker-specific monoclonal antibodies.

    +-++loLymphomas were classified as (A) B220sIg pro-B/pre-B, (B) B220sIgMsIgD B

     2

Michalak et al

    -+cell or (C) “mixed” pre-B/B cell if distinct sIg and sIg B lymphoma populations

    were present.

    Supplementary Figure 4 Loss of Puma affects the numbers of B lymphoid cells in E-myc mice in the absence of Noxa. (A) White blood cell counts (means ? SEM) of pre-neoplastic 4 week-old mice of the indicated noxa genotypes. Cell counts for E-

    myc mice of each of the noxa genotypes did not differ significantly, but the

    differences from their non-transgenic counterparts were highly significant (P < 0.0001). (B) Spleen weights (means ? SEM) of pre-neoplastic 5-6 week-old mice of the indicated noxa genotypes. Differences between non-transgenic and E-myc or

    -/-E-myc/noxa mice were significant (P < 0.001). Spleen weights of E-myc and E-

    -/-myc/noxa mice were similar (P = 0.76). (C) B lymphoid cell subset composition of

    lymph nodes, peripheral blood and spleen from pre-neoplastic 5-6 week-old mice of the indicated genotypes. Total cellularity and cell subset composition were determined as described in Supplementary Figure 1. For lymph nodes, statistically significant differences in addition to those indicated were noted for total cells and pre-

    -/-+/-B cells for E-myc vs E-myc/noxapuma mice. For peripheral blood, statistically

    significant differences in addition to those indicated were noted for all comparisons

    -/-except between E-myc vs E-myc/noxa mice. For spleen, statistically significant

    differences in addition to those indicated were noted for total cells, virgin B cells and

    -/-+/- mature B cells for E-myc vs E-myc/noxapumamice and for total cells, pre-B

    -/--/--/-cells and virgin B cells for E-myc/noxa and E-myc/noxapuma mice

    (P < 0.005). Values in (C) represent means ? SEM from 3-7 mice of each genotype. *

    P < 0.05, ** P < 0.01, *** P < 0.005.

     3

Michalak et al

Supplementary Figure 5 Loss of Noxa does not enhance the survival of E-myc

    transgenic B lymphoid cells in culture. Pro-B cells (A), pre-B cells (B) or virgin and mature B cells (C) were sorted from the bone marrow of 5-6 week old healthy wt mice or E-myc mice of the indicated noxa genotypes and cultured in simple medium

    (no added cytokines) or treated with etoposide (1 g/mL) for the indicated times. Cell

    --viability was determined by FACS analysis as the percentage of Annexin VPI cells.

     mice of each genotype. Data points represent means ? SEM of cells from 3-6

    -/--/-Statistically significant differences noted: E-myc vs E-myc/noxapuma and E-

    -/--/--/-myc/noxa vs E-myc/noxapuma, P < 0.5 for pro-B cells and virgin/mature B cells at 4 hours post etoposide only.

Supplementary Figure 6 Loss of Noxa does not accelerate lymphomagenesis in E-

    myc mice. Kaplan-Meier analysis of tumour-free survival of mice of the indicated

    +/-genotypes. Differences in tumour onset between E-myc and E-myc/noxa or E-

    -/-myc/noxa mice were not significant (P = 0.18 and P = 0.13, respectively).

    Supplementary Figure 7 Western blot analysis of p19Arf expression levels in lymphomas from E-myc mice of the various puma and noxa genotypes. Western blot

    analysis of p19Arf and ;-actin (loading control) on protein isolated from lymphoma suspensions from E-myc mice of the indicated puma and noxa genotype. Lysates

    -/-from p53 mouse embryonic fibroblasts (MEF) or a tumour (E-myc tumours known

    to be positive for p19Arf) were included as positive controls for p19Arf over-expression. Protein size standards in kDa are indicated on the left-hand side.

     4

Michalak et al

    Supplementary Figure 8 Assessment of p53 status and function in E-myc

    -lymphomas. (A) Genomic PCR of the Ink4A/arf locus revealed that no E-myc/puma

    /- lymphoma was observed to have a deletion of this gene. Controls: E-myc

    lymphoma cell line known to contain a deletion in the Ink4A/arf locus; spleen from an

    -/- Ink4A/arf deficient mouse; E-myc/p53lymphoma known to retain the Ink4A/arf locus; E-myc lymphoma known to retain the Ink4A/arf locus. (B) Assessment of p53 status and function in cohorts of E-myc lymphomas with or without Puma.

    *Lymphoma cell lines displayed p53 deficiency-like resistance following in vitro

    exposure to etoposide. ND = Not Done.

     5

Michalak et al

6

Report this document

For any questions or suggestions please email
cust-service@docsford.com