
By Doris Andrews,2014-07-18 02:21
8 views 0













    ;InstituteofLireSciences,JiangsuUniversity,Zhenjiang212013,China ;CollegeofLifeScience,HenanNormalUniversity,Xinxiang453007,China ;Receivedforpublication9July2007;revised24July2007;accepted24July2007












    ;canspecificallydetectnanosproteinexpressedinprokaryoticcells. ;Keywords:Bombyxmori;bioinformatics;nanos;primordialgermceils;RACE





    ;(Curtiseta1.,1995:Kobayashieta1.,1996;Calvoeta1., ;2005),Caenorhabditiselegans(Schanereta1.,2003), ;Cnidarians(Torrasetal.,2004;Extavouretal.,2005), ;leech(Helobdellarobusta)(Kangetal.,2002),mice(Mus ;musculu)(Tsudaetal.,2003),andhumans(Homosapiens) ;(Jaruzelskaeta1..2003).InDrosophila,nanosisrequired ;forprimordialgermcellmigrationandfate(Kobayashiet ;al..1996) ;repressingdifferentiation(Hayashietal.,2004:Wangand ;Lin,2004).Inzebrafish(Daniorerio),nanosisrequired ;formigrationandsurvivalofPGCs(Koprunnereta1.. ;Correspondingauthor.


    ;2001).Micehavethreenanos.1ikegenes.twoofwhichare ;expressedinPGCsandrequiredfortheirmaintenance ;(Tsudaeta1.,2003).


    ;gionsoftheinsectembryos(kisheta1.,1989;Wangand ;Lehmann,1991;Curtiseta1.,1995;LaUeta1.,2003;Calvo ;etal2005).InDrosophila,nanosRNAislocalizedtothe ;posteriorregionoftheembryo,andnanostranslationis ;repressedintherestoftheembryo,bythebindingofthe

    ;smaugproteintoanRNAsecondarystructureinthe ;3,_UTR(untranslatedregion)ofthenanosmRNA ;fDahanukareta1..1999).Nanosproteinregulates ;Hunchback(Hb)translationbyrecruitingacofactor, ;pumilio.whichbindsa”nanosresponseelement”inthe3

    ;UTRofthenchbackmRNA.thusrestrictingHbprotein ;expressiontotheanterioroftheembryo(Irisheta1.,1989) ;Thistranslationrepressionactivityintheposteriorofthe ;insectembryosaDpearstobeconservedintheorthopteran ;SchistocercaAmericana(Lal1eta1.,2003),wherenanos ;



    ;RNAisalsoposteriorlylocalized.Posteriorlylocafized ;nanosexpressionisalsofoundinmosquitoembryos ;(C~voeta1.,2005).However,thereisrarelyarelatedre- ;portaboutnanosinsilkworm(Bombyxmori).

    ;Expressedsequencetag(EST)databasesarevaluable ;resourcesfordiscoveringnovelgenesthroughffico ;cloning(Prigenteta1.,1999;Schultzeta1.,2000;Rinner ;andMorgenstem,2002).Inthisstudy,repeatedEST ;searching.multipleseqtIencecomparisons,andother

    ;data.miningtechniquesareemployedtoobtainnanosgene ;fromB.mori.C:ertainbioinformatictoolsarealsousedto ;analyzegenomicorganizationandtheencodedproteinof ;theisolatednanosgene.ToverifythenanosgeneinBom- ;byxmori.onefragmentofnanoswasexpressedinEs- ;cherichiacoliandtheantiserumwasproduced.Theresults ;0fmisstudyprovideusefulinformationforfuturestudies ;ontheB.morinanosgene.



    ;TheC108strainofB.moriwasusedforal1experiments. ;RneasyMiniKitwaspurchasedfromQIAGEN(VENLO. ;Netherlands).5.FllURACECoreSetPCRreagentsand ;pM18.TvectorwereobtainedfromTaKaCompany

    ;(Dalian,China).Otherreagentswerepurchasedfrom ;ShanghaiSangonBiotechnologyCorporation(Shanghai, ;China).

    ;DataextractionofcDNAsequenceofB.morinanosgene ;TheNCBI’s(

    ;baseisapopularstartingpointforidentifyingexpressed ;sequencetagsofdifferentspecies.andmorethan188.119 ;B.moriESTsequencesarecurrentlyavailableintheGen.

    ;Bank.AnothersilkwormcDNAdatabaseBGI(http: ;// ;nanosandthegenomeinthisstudy.ThenanosmRNA ;sequencefGenBankaccessionno.DQ288392)ofhoney

    ;bee(Apismellifera1wasused.tosearchforthecDNAse. ;quenceoftheB.morinano3gene,byrepeatedcyclesof ;blasting.


    ;Theovarywasdissectedfromthelarvaeonthefifthday ;ofthefifthinstar.frozenwith1iquidnitrogen.andground ;intopowder.TotalRNAwasextractedbyusingthe ;RneasyMiIliKitaccordingt0theusermanua1.Finally,the ;totalRNAwasinspectedwithGenespecHIfNakaInstru. ;mentsCo..Ltd.)andstoredat-70.Cforfurtheruse. ;Weused2IxgtotalRNAasatemplateinthefirst-strand ;cDNAsynthesis.Meanwhile.another2ggtotalRNAwas ;usedasatemplate,withthegenespecificprimer(GSP),in ;thefirst.strandcDNAsynthesis.andthennestedPCRwas ;performedusingtheprimersthatweredesignedto ;5RACE.basedonthesequenceobtainedfromtheNCBI ;database(GenBankaccessionno.AB017535).PCRcy- ;clingwascarriedoutat94.Cfor30s,60.Cfor30s,72.C

    ;for1min.for35cycles.ThePCRproductswereexamined ;byelectrophoresisin1%agarosegelfollowingethidium ;bromidestaining.

    ;ThespecificfragmentwasligatedintopM18..Tvector ;andthentransformedintoEcolffDH5strain).The

    ;plasmidwaspurifiedandsequencingwasperformedusing ;anautomaticsequencerCEQ8000(Beckman.Fullerton. ;USA1.


    ;TheprimersusedtoperformRACEweredesignedwith ;thesoftwareprimer5.0.cDNAdatabasesearcheswere ;performedusingBLAST(Altschuleta1.,1997).cDNA ;sequenceanalysiswasperformedusingtheDNAstar ;(DNASTAR,Madison,USA)Software.

    ;Thefirst130nucleotidesof3.UTRwereanalyzedus. ;ingthealgorithmmfoldversion3.1at ;;Zuker, ;2003).topredictthesecondarystructure.

    ;Toestablishthegenomicorganization,thecDNAse. ;quencewasblastedtothecontigsofB.morigenomeinthe ;GenBank.SIM4f ;usedtoalignthecDNAsequencewiththegenomicse.


    ;Proteinpredictionandphylogeneticanalysis ;TheExPASyTranslatetool(http://au.expasy.or# ;tools/dna.html,wasusedtodeducethecDNA’samino

    ;acidsequence,andsimilarityanalysiswasperformedusing ;theBLASTtoolintheGenBankrblastx)andSIBBLAST ;NetworkServicef}le ;deducedaminoacidsequencewascomparedwiththeho. ;mologysoftwareofGENEDOC(NRBSChttp://www. ;nrbsc.orgY).Asthedivergencetimeinvolvingmanyspe. ;ciescomparisonsandtheconfoundingeffectsofmultiple ;substitutionsinnucleotidesequencescouldoccurover ;longperiodsofevolutionarytime,weusedthededuced ;aminoacidsequencestoconstructphylogenetictrees.The ;treeswereconstructedusingtheMinimumEvolutionfM1

    ;method.M[Esearcheswereconductedusingthecomputer ;programM[EGA3fKumareta1..2004).

    ;Proteinexpression,purification,andpolyclonalantiserum ;production

    ;Oneencodingfragment(699bp)ofthenanosprotein ;wasamplifiedfromtheovarycDNAtemplateusingthe ;


    ;polymerasechainreaction(PCR).Asenseprimer ;5Latgaattcatgcgactcaatggcactg3(1cDRIsiteunderlined)


    ;3(XhoIsiteunderlined)wereusedinconstructionofthe ;recombinantplasmid.ThePCRamplifiedproductswere ;clonedtothepMD18Tvector,afterbeingverifledbvdi

    ;gestingwithEcoRIandXhoIrestrictionenzymes.and ;sequencingusinganautomaticsequencerCEQ8000 ;(Beckman,Fullerton.USA).Thedigestedfragmentwas ;subclonedintothepET30aexpressionvector(Novagen, ;LAJolla.USA).Recombinantvectorswereconfirmedby ;restrictiondigestionwithEcoRIandXhoIrestrictionen




    ;cherichiacolistrainBL21(DE3),apositiveclonewas ;culturedintheLBmediumandsupplementedwithkana

    ;mycin(50gg/mL)overnight,at37~(2,withshaking.This ;culturewasaddedtofleshLBmediumandctdturedat



    ;of0.2inmo1/Landfurtherculturedforanother10h.The ;recombinantproteinswereseparatedin10%SDS(define)

    PAGEwasperformedonthe ;polyacrylamidege1.SDS

    ;MiniProteinsystem(BioRad.California.USA).Thegel ;wasstainedwithCoomassieBrilliantBlueR250,tovisu


    ;Topurifythenanos6Hisfusionprotein,theinduced ;bacterialcellpeHetwascollected,lysised,andpurified ;usingtheNiresin(Novagen,LAJolla,USA),andthepu


    ;againstthenanos6HisfusionproteinwereraisedinNew ;Zealandwhiterabbits.




    ;AfterrepeatedcyclesofblastinginNCBI.usingthe ;honeybeenanosmRNAsequence,onenanosrelated ;cDNA(GenBankaccessionno.AB017535)ofB.moriwas ;obtained.APCRfragmentabout500bpinlengthwasob




Report this document

For any questions or suggestions please email