DOC

Additional file 4 PCR primer sequences and final concentration

By Greg Dixon,2014-12-24 13:52
11 views 0
Additional file 4 PCR primer sequences and final concentration

Supplementary Table 2. PCR primer sequences and final concentration

    Gene Primer Name Primer Sequence 5′ - 3′ Final

    concentra

    tion (nM) AGT AGT3F CTGACCCGAATGAAGAATCTCTCT 900

     AGT4R CTGATTTTGCCCAGGTTTGC 900 ANXA2 ANXA2F AACCAGGAGCTGCAGGAGATC 900

     ANXA2R CGGAAGTCGCCAGATGTGT 900 CAT CAT10F TCAACAGTGCCAGCGATGAC 300

     CAT11R AGATGGCCCGCAATGTTCT 300 FTL FTL1F AACTGCGGGCCTCCTACAC 300

     FTL1R CGCCCTCGCGCTTCT 300 GIMAP4 GIMAP4F3 CAGCAAAAGTGGAAGGTGGAA 300

     GIMAP4R3 TGCTGCCTTGAAACCCAGTAA 300 Ovar-OLADQA11F TGAGAACAGGATGATCCTGAACAG 900 DQA1

     OLADQA12R TGGTAGACGTTTACGCCATAGATG 900

     DQA1exon2F AATGGAGCCCACAATGTTTG 400

     DQA1exon2R TGTCCTTGGAAGGAGAGAGTTT 400

     DQA1seqF CAACTCCGAACAGCAACTTC 400

     DQA1seqR TTCTCAGTGCACCCTGAGG 400

     DQAintronF2 ACTGGACAACTATCAACACAG 400

     DQAexonR2 CGTAGAACTCTTCATCTCCATC 400 Ovar-2OLADQB13F CCCCAGCGAGGAGATGTCTA 300

DQB1

     2OLADQB14R AAGATCAGCCCCAGCACAAA 300 Ovar-OLADRAF AAGCCAACCTGGACATCATGAT 300 DRA

     OLADRAR ATCACGGGTGGCGAGAACT 300 LGALS2 LGALS2F TTGAGATTGCGAACATGGACAT 300

     LGALS2R CACCAAAGCGTGGGTTGAA 300 MYLK MYLK29F GTGGAGGGAAGTGCTGCAA 300

     MYLK30R CTCCCGGATTGATTGGTCAT 300 PolR2E POLR2E3F TGTACTGTCAGCGCATGCA 300

     POLR2E4R TGGGTGCCATGTCAACCA 300

Report this document

For any questions or suggestions please email
cust-service@docsford.com