DOC

GAPDH PCR modul

By Gerald Murray,2014-12-23 21:04
5 views 0
GAPDH PCR modul

GAPDH PCR modul

    GAPDH PCR modul

    Manual

    Katalog nr. 166-5010EDU

    explorer.bio-rad.com

    Kopiering kun tilladt til undervisningsbrug

    Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende dele

    til opbevaring ved den anbefalede temperatur.

    Oversat og bearbejdet af

    Birgit Sandermann Justesen

    Nærum Gymnasium, februar 2009

1/12

GAPDH PCR modul

Indledning

    PCR er i dag en meget benyttet teknologi i forskning, i retsgenetiske analyser og i laboratorier. Blandt de mange anvendelsesmuligheder af PCR er også muligheden for at bruge PCR til at klone gener også i tilfælde, hvor man ikke kender genomet. Ved at designe primerne ud fra kendte beslægtede organismers DNA er det muligt at få amplificeret de gener, man ønsker. Metoden, der kaldes nested DNA, er en to-

    trinsproces. I den første PCR-runde amplificeres de gener, der har sekvenser, der ligner det gen, der skal undersøges. I den anden runde PCR amplificeres mere specifikt de gener, der har interesse efter første runde.

Overblik

    Teori: DNA, DNAreplikation, PCR, primerdesign, de generede primere, nedsted PCR For-forsøg: ekstration af genomDNA fra forskelligt plantemateriale (Nukleinsyreekstraktion)

    Del 1: Klargøre til første PCR, PCR, elektroforese og analyse af resultaterne Del 2: Behandling af DNA med exonuclease, klargøre til PCR, PCR, elektroforese og analyse af resultaterne

    Afslutning: Opsamling og endelig tolkning af resultaterne

Elevforudsætninger

    Kittet kræver et større overblik og er derfor designet til elever, der har enten molekylær biologi eller bioteknologi på A-niveau. Det forudsættes, at eleverne allerede har kendskab til og prøvet PCR-teknikken.

Tjekliste

    I kittet Mængde

    Initial GAPDH PCR-primer 50;L 1

    Nested GAPDHPCR-primers 50;L 1

    PCR master mix 1,2mL 3

    Plasmid control DNA 1 mL 1

    Control Arabidopsis genomDNA 1

    Exonuclease I, 50;L 1

    Molekylær vægt-lineal 1

    Sterilt vand 2,5mL 1

    PCR-rør 0,2mL 150

    Adaptorer til PCR-rør 1,5ml 150

    Farvede mikrocentrifugerør 120

    Skumholdere til mikrocentrifugerørene 12

Nødvendigt udstyr

    Mikropipette 2-20;L 1 pr. gruppe

    Mikropipette 20-200;L 1 pr. gruppe

    Pipettespidser med aerosolbarriere til ovennævnte pipetter

    PCR-maskine

    Elektroforeseudstyr

Udstyr det er rart at have

    Nyt ekstraheret plante DNA (fra kittet ”Nukleinsyreekstraktion”)

2/12

GAPDH PCR modul

    Ultracentrifuge

    Vortexer

    Enten ethidium-agarose elektroforeseudstyr eller fast-blast-agarose elektroforeseudstyr

Teori

    xxx

Lærerens forberedelse

    Teoretiske noter

    I dette forsøg skal eleverne lave to runder med PCR. For at amplificere en del af GAPC-genet fra genom DNA. Genom-DNA kan skaffes på 3 måder 1) GenomDNA udvundet ved ekstraktion af plantemateriale eller2) fra et forskningslaboratorium eller 3) ved at bruge det i kittet medfølgende Arabidopsis genom DNA. I den første PCR

    benyttes degenererede primere for at amplificere en større del af DNA stykkerne. I modsætning til normale primere, der er syntetiserede med en nucleotid på hver position har degenererede primere en eller flere positioner, hvor der er syntetiseret forskellige nukleotider.

    Start (initial) primeren ser sådan ud:

     GABTATGTTGTTGARTCTTCWGG

    Degenereringen ses i position 3, 15 og 21

Position IUB kode Baser

    3 B G/T/C

    15 R(purin) G/A

    21 W(Weak) A/T

Den reverse primer er dannet på samme måde.

    I anden PCR-runde i ’nested PCR’ benyttes mere specifikke primere til at amplificere et specifikt GAPCgen fra genom-poolen. Disse primere er ikke degenererede, men findes inde i sekvensen fra de første primere. Se fx:

Initial primer GABTATGTTGTTGARTCTTCWGG

    Nested primer CTACTGGTGTCTTCACTGACAA

    Primerne binder ikke lige godt til alle plantearter, hvorfor der vil være forskellig PCR-effektivitet hos de forskellige arter. Det kan sagtens ske, at eleverne allerede efter første PCR-runde får fragmenter , der er gode nok til at klone. Det vil sige at der er nok DNA (der kan ses bånd på en gel), kvaliteten er god nok (der er et eller flere bånd) og fragmenterne har den forventede størrelse. Men for at være på den sikre side anbefales det på det kraftigste, at man gennemfører begge PCR-runder. Det kan dog stadig ske, at nogle elever selv efter to PCR-runder ikke har fået nok DNA. Hvis eleverne benytter det DNA, de selv har ekstraheret fra plantemateriale anbefales det, at de som kontrol benytter de Arabidopsis genom-DNA, der følger med kittet.

    Derudover følger der med kittet plasmid DNA, der koder for target(mål)delen af GAPDHgenet fra Arabidopsis og hvis dette benyttes som skabelon i begge PCR-

    runder er man sikker på, at PCR’en virker. Ved at lave disse forskellige kontrolforanstaltninger lærer eleverne noget om kontrollers betydning, men samtidig

3/12

GAPDH PCR modul

    kan kontrolreaktionen fungere som en slags klonbar PCRprodukt, hvis deres egne prøver ikke virker.

    Endelig anbefales det at man også arbejder med en negativ kontrol.

Lærerens forberedelse

    1. Fortynd 5x genom Arabidopsis DNA (25ng/;L) med sterilt vand til 5ng/;L.

    Det gøres ved at tage 20 ;L DNA og blande med 80;L vand. Blandes godt.

    Hver gruppe har brug for 6;L.

    2. Læreren kan evt. blande mastermixen med primere.

     Elevvejledningen lægger dog op til, at eleverne ud fra beregninger af molaritet

     selv blander deres mastermix med primere. Tidligst 30 minutter før forsøget

     blandes mastermixen. Hver gruppe skal bruge 120;L 2x mastermix med

     primere til 5 PCR reaktioner. Tilsæt 30;L specifikke primere (blå i første

     runde, gul nested primere i anden runde) til 1500;L BioRad2x mastermix

     bland godt

    3. Før anden PCR-runde placeres exonuclease I på is

    4. Fremstil 500bp molekylær vægtlinealen: Tilsæt 100;L 5x orange G Loading

    Dye til den medfølgende 500bp molekyl-vægt-lineal

    5. Læreren eller elever gør klar til at lave elektroforese. Der støbes 1%

    agarosegel i TAE-buffer. Hver gruppe har brug for to geler.

    6. Programmer PCR-maskinen

    Første PCR-runde initial GAPDHPCR: oStart denaturering 95 C i 5 minutter

    Derefter 40 cykler: o Denaturering 95 C i 1 minut o Annealing 52 C i 1 minut o Extension 72 C i 2 minutter oAfslutnings extension 72 C i 6 minutter oSlut 15 C uendeligt

    Anden PCRrunde nested GAPDHPCR: oStart denaturering 95 C i 5 minutter

    Derefter 40 cykler: o Denaturering 95 C i 1 minut o Annealing 46 C i 1 minut o Extension 72 C i 2 minutter oAfslutnings extension 72 C i 6 minutter oSlut 15 C uendeligt

4/12

GAPDH PCR modul

    Elevvejledning

    Det gen, der skal analyseres skal studeres i dette forsøg koder for GAPDH dvs.

    glycerolaldehydfosfatdehydrogenase, - et af glykolysens enzymer. GAPDH er et

    meget vigtigt enzym i glykolysen (Læs selv om glykolysen i din biokemibog) og det udtrykkes konstant og samtidig er det livsvigtigt for cellens overlevelse. Eftersom der er rigeligt med GAPDH i cellerne og det er muligt at oprense enzymet ved man også meget om enzymet proteinstruktur og dets funktion. GAPDH består af 4 underenheder der holdes sammen af ikke-kovalente bindindinger. I nogle tilfælde er alle fire underenheder ens, i andre tilfælde er der små forskelle. Hver underenhed har +et aktivt område, hvor der kan bindes en NAD co-faktor.

    Selvom der er GAPDH i alle organismer er det ikke ensbetydende med, at organismernes genetiske kode for GAPDH er ens, idet mængde og størrelsen af fx introns kan variere. I første PCR runde bruges der en primer, der stammer fra nærtbeslægtede organismer, som Arabidopsis (også en plante) og denne primer vil nok virke, men ikke optimalt. Men der amplificeres dog en del Dna og i anden PCR-runde kan man være mere specifik med hensyn til at ”fange” det DNA, der koder for GAPDH.

Materialer pr. gruppe:

    BioRad 2x master-mix 120 ;L

    Blå initial primer 4 ;L

    gDNA fra planter (tidligere forsøg) 2

    1x Arabidopsis gDNA (fortyndet til 5ng/;L) 6 ;L

    Kontrol pGAP plasmid DNA 6 ;L

    2-20 ;L mikropipette

    spidser til mikropipetten

    PCR-rør 5

    PCR-adaptorer 5

    Mikrocentrifugerør 1

    Holder til rørene

    Tusch

    isbad

Første PCR-runde (Initial PCR)

    Bemærkning: Såfremt læreren fremstiller mastermixen springes punkt 3 over.

    1. Gruppen starter med planlægningen af første PCR-runde. I startrunden skal

    der laves PCR på Arabidopsis gDNA (gDNA=genomDNA), på pGAP plasmid

    DNA (positiv kontrol), på mindst én plantes gDNA samt på en negativ kontrol,

    som består af sterilt vand i stedet for DNA. Tegn en tabel så I har styr på, hvad

    der står på de pågældende rør, hvilken skabelon, der er benyttet og hvilke

    primere, der har været brugt.

Mærke på PCR-røret Skabelon Primere

5/12

    GAPDH PCR modul

    2. Tidligst 30 minutter før PCR-reaktionen skal starte, fremstiller I jeres

    mastermix.

    Mastermix er er en blanding bestående af alle de reagenser, der er nødvendige

    for PCR nemlig Taq polymerase, dNTP, buffer og salt. Mastermixen er dog

    først klar til brug, når der også er tilsat primere.

    I kittet er der en 2x mastermix (klar væske). Denne vil, når den blandes i PCR-

    rørene med en tilsvarende mængde DNA-skabelon (jeres prøver, der skal

    køres PCR på) opnå den rette koncentration; 1x.

    Vi skal nu beregne, hvor meget mastermix , der skal bruges:

    Hver PCR-prøve kræver 40;L. Dvs. hver prøve skal bruge 20;L 2xMMIP

    (dvs 2x mastermix initial primere) plus 20;L DNA-skabelon.

    Hvis I således regner med at køre 5 prøver skal I i alt bruge 5 x 20;L

    2xMMIP. Dertil skal I nu beregne, hvor megen initial-primer, der skal

    tilsættes: Primeren leveres i en koncentration på 100;M og den er blå. Til

    selve PCR’en kræves kun en koncentration på 2;M.

    Beregn nu hvor meget initial-primer, der skal tilsættes 2xMMIP:

    Formel: M x V/M=V 1122

    Vi har altså:

    Mængde initial-primer i ;L=

     (koncentration af primer i ;M)x(volumen af 2xMMIP i ;L)

     (given primer-koncentration i ;M)

    Tidligst 30 minutter før starten på PCR tilsætter I den beregnede mængde

    initial-primer til den afmålte mængde 2xMMIP (mastermix) i et skruelågs-

    mikrocentrifugerør. Bland grundigt ved at knipse på røret eller brug en

    vortexer. Den færdige blanding er blå

    Stil det på is!

    Note: Initial-primerne sætter sig fast udenfor selve target-området. (Se mere i

    jeres teoribøger om dette)

3. Mærk 5 PCR-rør med jeres initialer og

     følgende numre:

    1 Negativ kontrol (sterilt vand)

    2 Arabidopsis gDNA

    3 Positiv kontrol pGAP plasmid

    4 Plante 1 gDNA

    5 Plante 2 gDNA

    4. Stil rørene i en PCR-adaptor, luk hvert

     rør og stil PCR-adaptorerne med

     PCR-rørene på is.

    6/12

    GAPDH PCR modul

    5. Tag den færdigblandede blå mastermix

     og knips på røret og giv det evt. en kort

     centrifugering for at få indholdet ned i

     bunden

6. Tilsæt 20;L færdigblandet blå mastermix

     til hvert af de 5 mærkede rør

     Blå mastermix

7. Skift pipettespids og tilsæt 15;L sterilt

     vand til hvert rør

     sterilt vand

    8. Tilsæt 5;L negativ kontrol til det første rør.

     Sug forsigtigt op og ned med pipetten for

     at blande godt.

    Skift spids og tilsæt 5;L Arabidopsis gDNA til rør nr. 2 bland

    Skift spids og tilsæt 5;L positiv kontrol til rør 3 bland

    Skift spids og tilsæt 5;L plante 1 gDNA til rør 4 - bland

    Skift spids og tilsæt 5;L plante 2 gDNA til rør 5 bland

     DNA-prøver

    9. Når alle grupper er klar stilles rørene i

     PCR-maskinen

10. Start PCRreaktionen:

    Første PCR-runde initial GAPDHPCR: oStart denaturering 95 C i 5 minutter

    Derefter 40 cykler: o Denaturering 95 C i 1 minut o Annealing 52 C i 1 minut o Ekstension 72 C i 2 minutter oAfslutnings-ekstension 72 C i 6 minutter o Slut 15 C uendeligt

    7/12

    GAPDH PCR modul

     Hvis der er overskydende gDNA stilles det straks i fryseren

11. Gør klar til elektroforese. Støb en 1% agarosegel

     i TAE-buffer

    12. Tag prøverne ud af PCR-maskinen

    13. Mærk 5 mikrocentrifugerør som før og tilsæt

     5;L 5x Orange Loading Dye til hvert rør.

    14. Afpipetter 20;L fra hvert af de respektive rør til de nye rør. Sug op og ned

    med pipetten for at blande. Vigtigt! De resterende 20;L i PCR-rørene skal

    bruges til anden PCR-runde!

    15. Sæt 10;L 500bp molekyl-vægt-lineal i første brønd og derefter 20;L af hver

    prøve i de næste brønde. Noter rækkefølgen. Kør elektroforesen

    Bemærk: Båndene i molekyl-vægt-linealen er: 500, 1000, 1500, 2000, 2500,

    3000, 3500, 4000, 4500 og 5000bp

    16. Studer resultatet og noter det.

    Bemærk: pGAP-plasmidkontrollen skulle gerne vise et bånd ved ca 1kb. For

    plante gDNA er det relativt normalt, at der ses flere bånd eller modsat kun

    yderst svage bånd. Der kan dog sagtens stadig være gode muligheder for

    amplificering i anden PCR-runde.

    17. Den del af prøverne, der skal arbejdes videre med, stilles i køleskabet!

    8/12

    GAPDH PCR modul

    Anden PCR-runde (Nested PCR)

    1. I skal nu planlægge jeres nested-PCR eksperiment. Der vil blive udført nested-

    PCR på de prøver, der indeholdt gDNA (gDNA=genomDNA). Derudover

    laves der såvel en positiv kontrol som en negativ kontrol. Som i første del

    laver I en oversigtstabel over indholdet i de forskellige rør:

    Mærke på PCR-skabelon Fortyndingsfaktor Primere

    røret

    2. Tidligst 30 minutter før PCR-reaktionen skal starte, fremstiller I jeres

    mastermix.

    Mastermix er er en blanding bestående af alle de reagenser, der er nødvendige

    for PCR nemlig Taq polymerase, dNTP, buffer og salt. Mastermixen er dog

    først klar til brug, når der også er tilsat primere.

    I kittet er der en 2x mastermix (klar væske). Denne vil, når den blandes i PCR-

    rørene med en tilsvarende mængde DNA-skabelon (jeres prøver, der skal

    køres PCR på) opnå den rette koncentration; 1x.

    Vi skal nu beregne, hvor meget mastermix , der skal bruges:

    Hver PCR-prøve kræver 40;L. Dvs. hver prøve skal bruge 20;L 2xMMNP

    (dvs 2x mastermix nested primere) plus 20;L DNA-skabelon.

    Hvis I således regner med at køre 5 prøver skal I i alt bruge 5 x 20;L

    2xMMNP. Dertil skal I nu beregne, hvor megen nested-primer, der skal

    tilsættes: Primeren leveres i en koncentration på 25;M og den er gul. Til selve

    PCR’en kræves kun en koncentration på 0,5;M.

    Beregn nu hvor meget nested-primer, der skal tilsættes 2xMMNP:

    Formel: M x V/M=V 1122

    Vi har altså:

    Mængde nested-primer i ;L=

     (koncentration af primer i ;M)x(volumen af 2xMMNP i ;L)

     (given primer-koncentration i ;M)

    Tidligst 30 minutter før starten på PCR tilsætter I den beregnede mængde gul

    nested-primer til den afmålte mængde 2xMMNP (mastermix) i et skruelågs-

    mikrocentrifugerør. Bland grundigt ved at knipse på røret eller brug en

    vortexer. Den færdige blanding er gul

    Stil det på is!

    Note: nested-primerne arbejder på selve target-området. (Se mere i jeres

    teoribøger om dette)

    9/12

GAPDH PCR modul

    3. Først skal ikke-inkorporerede primere fra første

     runde fjernes ved hjælp af exonuclease I.

     Brug en ny pipettespids hver gang når I pipetterer

     1;L exonuclease I til hvert ’Første-runde-PCR-rør, der

     indeholder gDNA (dvs. rør 2, 4 og 5). Bland godt.

     o4. Inkuber i 15 minutter ved 37 C

     o 37C vandbad

    5. Inaktiver enzymet ved derefter at inkubere i o 15 minutter ved 80 C.

     o 80C vandbad

    Hvorfor er det nødvendigt at inaktivere exonucleasen?

    6. Mærk et mikrocentrifugerør til hvert af de

     exonuclasebehandlede første-runde-PCR-rør.

     exo Arabidopsis gDNA

     exo plante 1 gDNA

     exo plante 2 gDNA

    7. PCR’en fra første runde skal nu fortyndes.

     Tilsæt 98;L sterilt vand til hvert af mikrocentri-

     fugerørene

     sterilt vand

    8. Skift pipettespids og tilsæt 2;L af de respektive

    exonucleasebehandlede PCR-prøver til de

    tilsvarende mærkede mikrocentrifugerør.

    Luk låget

     exonucleasebehandlede PCR-prøver

10/12

Report this document

For any questions or suggestions please email
cust-service@docsford.com