DOC

GAPDH PCR modul

By Gerald Murray,2014-12-23 21:04
8 views 0
GAPDH PCR modul

GAPDH PCR modul

    GAPDH PCR modul

    Manual

    Katalog nr. 166-5010EDU

    explorer.bio-rad.com

    Kopiering kun tilladt til undervisningsbrug

    Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende dele

    til opbevaring ved den anbefalede temperatur.

    Oversat og bearbejdet af

    Birgit Sandermann Justesen

    Nærum Gymnasium, februar 2009

1/12

GAPDH PCR modul

Indledning

    PCR er i dag en meget benyttet teknologi i forskning, i retsgenetiske analyser og i laboratorier. Blandt de mange anvendelsesmuligheder af PCR er også muligheden for at bruge PCR til at klone gener også i tilfælde, hvor man ikke kender genomet. Ved at designe primerne ud fra kendte beslægtede organismers DNA er det muligt at få amplificeret de gener, man ønsker. Metoden, der kaldes nested DNA, er en to-

    trinsproces. I den første PCR-runde amplificeres de gener, der har sekvenser, der ligner det gen, der skal undersøges. I den anden runde PCR amplificeres mere specifikt de gener, der har interesse efter første runde.

Overblik

    Teori: DNA, DNAreplikation, PCR, primerdesign, de generede primere, nedsted PCR For-forsøg: ekstration af genomDNA fra forskelligt plantemateriale (Nukleinsyreekstraktion)

    Del 1: Klargøre til første PCR, PCR, elektroforese og analyse af resultaterne Del 2: Behandling af DNA med exonuclease, klargøre til PCR, PCR, elektroforese og analyse af resultaterne

    Afslutning: Opsamling og endelig tolkning af resultaterne

Elevforudsætninger

    Kittet kræver et større overblik og er derfor designet til elever, der har enten molekylær biologi eller bioteknologi på A-niveau. Det forudsættes, at eleverne allerede har kendskab til og prøvet PCR-teknikken.

Tjekliste

    I kittet Mængde

    Initial GAPDH PCR-primer 50;L 1

    Nested GAPDHPCR-primers 50;L 1

    PCR master mix 1,2mL 3

    Plasmid control DNA 1 mL 1

    Control Arabidopsis genomDNA 1

    Exonuclease I, 50;L 1

    Molekylær vægt-lineal 1

    Sterilt vand 2,5mL 1

    PCR-rør 0,2mL 150

    Adaptorer til PCR-rør 1,5ml 150

    Farvede mikrocentrifugerør 120

    Skumholdere til mikrocentrifugerørene 12

Nødvendigt udstyr

    Mikropipette 2-20;L 1 pr. gruppe

    Mikropipette 20-200;L 1 pr. gruppe

    Pipettespidser med aerosolbarriere til ovennævnte pipetter

    PCR-maskine

    Elektroforeseudstyr

Udstyr det er rart at have

    Nyt ekstraheret plante DNA (fra kittet ”Nukleinsyreekstraktion”)

2/12

GAPDH PCR modul

    Ultracentrifuge

    Vortexer

    Enten ethidium-agarose elektroforeseudstyr eller fast-blast-agarose elektroforeseudstyr

Teori

    xxx

Lærerens forberedelse

    Teoretiske noter

    I dette forsøg skal eleverne lave to runder med PCR. For at amplificere en del af GAPC-genet fra genom DNA. Genom-DNA kan skaffes på 3 måder 1) GenomDNA udvundet ved ekstraktion af plantemateriale eller2) fra et forskningslaboratorium eller 3) ved at bruge det i kittet medfølgende Arabidopsis genom DNA. I den første PCR

    benyttes degenererede primere for at amplificere en større del af DNA stykkerne. I modsætning til normale primere, der er syntetiserede med en nucleotid på hver position har degenererede primere en eller flere positioner, hvor der er syntetiseret forskellige nukleotider.

    Start (initial) primeren ser sådan ud:

     GABTATGTTGTTGARTCTTCWGG

    Degenereringen ses i position 3, 15 og 21

Position IUB kode Baser

    3 B G/T/C

    15 R(purin) G/A

    21 W(Weak) A/T

Den reverse primer er dannet på samme måde.

    I anden PCR-runde i ’nested PCR’ benyttes mere specifikke primere til at amplificere et specifikt GAPCgen fra genom-poolen. Disse primere er ikke degenererede, men findes inde i sekvensen fra de første primere. Se fx:

Initial primer GABTATGTTGTTGARTCTTCWGG

    Nested primer CTACTGGTGTCTTCACTGACAA

    Primerne binder ikke lige godt til alle plantearter, hvorfor der vil være forskellig PCR-effektivitet hos de forskellige arter. Det kan sagtens ske, at eleverne allerede efter første PCR-runde får fragmenter , der er gode nok til at klone. Det vil sige at der er nok DNA (der kan ses bånd på en gel), kvaliteten er god nok (der er et eller flere bånd) og fragmenterne har den forventede størrelse. Men for at være på den sikre side anbefales det på det kraftigste, at man gennemfører begge PCR-runder. Det kan dog stadig ske, at nogle elever selv efter to PCR-runder ikke har fået nok DNA. Hvis eleverne benytter det DNA, de selv har ekstraheret fra plantemateriale anbefales det, at de som kontrol benytter de Arabidopsis genom-DNA, der følger med kittet.

    Derudover følger der med kittet plasmid DNA, der koder for target(mål)delen af GAPDHgenet fra Arabidopsis og hvis dette benyttes som skabelon i begge PCR-

    runder er man sikker på, at PCR’en virker. Ved at lave disse forskellige kontrolforanstaltninger lærer eleverne noget om kontrollers betydning, men samtidig

3/12

GAPDH PCR modul

    kan kontrolreaktionen fungere som en slags klonbar PCRprodukt, hvis deres egne prøver ikke virker.

    Endelig anbefales det at man også arbejder med en negativ kontrol.

Lærerens forberedelse

    1. Fortynd 5x genom Arabidopsis DNA (25ng/;L) med sterilt vand til 5ng/;L.

    Det gøres ved at tage 20 ;L DNA og blande med 80;L vand. Blandes godt.

    Hver gruppe har brug for 6;L.

    2. Læreren kan evt. blande mastermixen med primere.

     Elevvejledningen lægger dog op til, at eleverne ud fra beregninger af molaritet

     selv blander deres mastermix med primere. Tidligst 30 minutter før forsøget

     blandes mastermixen. Hver gruppe skal bruge 120;L 2x mastermix med

     primere til 5 PCR reaktioner. Tilsæt 30;L specifikke primere (blå i første

     runde, gul nested primere i anden runde) til 1500;L BioRad2x mastermix

     bland godt

    3. Før anden PCR-runde placeres exonuclease I på is

    4. Fremstil 500bp molekylær vægtlinealen: Tilsæt 100;L 5x orange G Loading

    Dye til den medfølgende 500bp molekyl-vægt-lineal

    5. Læreren eller elever gør klar til at lave elektroforese. Der støbes 1%

    agarosegel i TAE-buffer. Hver gruppe har brug for to geler.

    6. Programmer PCR-maskinen

    Første PCR-runde initial GAPDHPCR: oStart denaturering 95 C i 5 minutter

    Derefter 40 cykler: o Denaturering 95 C i 1 minut o Annealing 52 C i 1 minut o Extension 72 C i 2 minutter oAfslutnings extension 72 C i 6 minutter oSlut 15 C uendeligt

    Anden PCRrunde nested GAPDHPCR: oStart denaturering 95 C i 5 minutter

    Derefter 40 cykler: o Denaturering 95 C i 1 minut o Annealing 46 C i 1 minut o Extension 72 C i 2 minutter oAfslutnings extension 72 C i 6 minutter oSlut 15 C uendeligt