JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2010, p. 3708–3718 Vol. 48, No. 10 0095-1137/10/$12.00 doi:10.1128/JCM.00989-10 Copyright ? 2010, American Society for Microbiology. All Rights Reserved.
Internet-Accessible DNA Sequence Database for Identifying
Fusaria from Human and Animal Infections
1223Kerry O‘Donnell,* Deanna A. Sutton,Michael G. Rinaldi,Brice A. J. Sarver, 456S. Arunmozhi Balajee,Hans-Josef Schroers,Richard C. Summerbell, 778Vincent A. R. G. Robert,Pedro W. Crous,Ning Zhang, 91010Takayuki Aoki,Kyongyong Jung,Jongsun Park, 101111Yong-Hwan Lee,Seogchan Kang,Bongsoo Park, 11and David M. Geiser
Bacterial Foodborne Pathogens and Mycology Research Unit, Agricultural Research Service, U.S. Department of Agriculture, Peoria, 12Illinois; Department of Pathology, University of Texas Health Science Center, San Antonio, Texas; Department of 3Biological Sciences, University of Idaho, Moscow, Idaho; Centers for Disease Control and Prevention, Atlanta, 456Georgia; Agricultural Institute of Slovenia, Ljubljana, Slovenia; Sporometrics Inc., Toronto, Canada; 7CBS-KNAW Fungal Biodiversity Center, Utrecht, Netherlands; Department of Plant Biology and 8Pathology, Rutgers University, New Brunswick, New Jersey; NIAS Genebank (MAFF),
National Institute of Agrobiological Sciences, 2-1-2, Kannondai, Tsukuba, 9Ibaraki 305-8602, Japan; Department of Agricultural Biotechnology, 10Seoul National University, Seoul 151-921, South Korea; and
Department of Plant Pathology, The Pennsylvania State 11University, University Park, Pennsylvania
Received 17 May 2010/Returned for modi，cation 1 July 2010/Accepted 27 July 2010
Because less than one-third of clinically relevant fusaria can be accurately identi；ed to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identi；cation of the 69 Fusarium species associated with human or animal mycoses encountered in clinical microbiology laboratories. The database comprises partial sequences from three nuclear genes: translation elongation factor 1 (EF-1 ), the largest subunit of RNA polymerase (RPB1), and the second largest subunit of RNA polymerase (RPB2). These three gene fragments can be ampli；ed by PCR and sequenced using primers that are conserved across the phylogenetic breadth of Fusarium. Phylogenetic analyses of the combined data set reveal that, with the exception of two monotypic lineages, all clinically relevant fusaria are nested in one of eight variously sized and strongly supported species complexes. The monophyletic lineages have been named informally to facilitate communication of an isolate’s clade member- ship and genetic diversity. To identify isolates to the species included within the database, partial DNA sequence data from one or more of the three genes can be used as a BLAST query against the database which is Web accessible at FUSARIUM-ID (http://isolate.fusariumdb.org) and the Centraalbureau voor Schimmel- cultures (CBS-KNAW) Fungal Biodiversity Center (http://www.cbs.knaw.nl/fusarium). Alternatively, isolates can be identi；ed via phylogenetic analysis by adding sequences of unknowns to the DNA sequence alignment, which can be downloaded from the two aforementioned websites. The utility of this database should increase signi；cantly as members of the clinical microbiology community deposit in internationally accessible culture collections (e.g., CBS-KNAW or the Fusarium Research Center) cultures of novel mycosis-associated fusaria, along with associated, corrected sequence chromatograms and data, so that the sequence results can be veri；ed and isolates are made available for future study.
In addition to being the single most important genus of trauma-associated keratitis, or locally invasive infections, toxigenic phytopathogens (40), Fusarium (Hypocreales, such as sinusitis, catheter-associated peritonitis, pneumonia, Ascomycota) has emerged over the past 3 decades as one of or diabetic cellulitis (77). The 2005-2006 keratitis outbreaks the most important genera of ，lamentous fungi responsible within the United States and Asia, however, were unusual in for deeply invasive, opportunistic infections in humans (83). that they were linked to the use of a novel soft contact lens Clinically, fusarioses in immunocompetent patients typically cleaning solution, which was subsequently removed from the present as super，cial infections, such as onychomycosis and market (11). In contrast, immunocompromised or immuno- suppressed patients who are persistently and profoundly neutropenic may acquire life-threatening angioinvasive, he- * Corresponding author. Mailing address: Bacterial Foodborne matogenously disseminated fusarial infections associated Pathogens and Mycology Research Unit, National Center for Agricul- tural Utilization Research, Agricultural Research Service, United with high morbidity and mortality rates (15). The high mor- States Department of Agriculture, 1815 North University Street, Peo- tality of immunosuppressed patients is due in part to the ria, IL 61604-3999. Phone: (309) 681-6383. Fax: (309) 681-6672. broad resistance of most fusaria to the spectrum of antifun- E-mail: kerry.odonnell@ars.usda.gov. gals currently available (1, 4–7, 56); liposomal amphotericin Published ahead of print on 4 August 2010.
3708
VOL. 48, 2010 MOLECULAR IDENTIFICATION OF HUMAN PATHOGENIC FUSARIA 3709
B shows the greatest ef，cacy among the drugs currently in with the aim of developing a comprehensive DNA sequence
database that includes a representative of all presently known use (3, 17, 66).
human/animal pathogenic Fusarium species identi，ed previ- A series of molecular phylogenetic studies has led to the
ously using GCPSR. important conceptual advance that morphological species rec-
ognition within Fusarium (22, 38, 47) greatly underestimates its Toward this end, a three-locus DNA sequence database for
all known human opportunistic/pathogenic fusaria (i.e., 69 spe- species diversity (49, 50, 53, 54–57, 59, 70, 85). This ，nding is
cies) was developed to meet the following four objectives: (i) not too surprising, given that phenotypic methods for identi-
fying fusaria rely on relatively few morphological and cultural determine the utility of single- and multilocus DNA sequence characters (75). Based on an extensive literature review, Nucci data (EF-1 , RPB1, and RPB2) for accurately identifying clin- and Anaissie (48) recently recorded 12 morphospecies associ- ically important fusaria to species level, including partial se- ated with fusarial infections within the immunocompromised quence data from the DNA-directed RNA polymerase largest patient population. However, phylogenetic species recognition subunit (RPB1), which is used here for the ，rst time for
based on genealogical concordance of multilocus DNA se- phylogenetic inference within Fusarium; (ii) investigate the
quence data (herein referred to as GCPSR) (79) has identi，ed phylogenetic diversity and evolutionary relationships of myco- at least 69 clinically important Fusarium species (Table 1) (49, sis-associated fusaria; (iii) provide an Internet-accessible, 54, 56, 57, 70, 85). Phylogenetic species in these studies were three-locus database for accurately identifying and placing recognized if they received 70% maximum parsimony (MP) novel etiologic agents of fusarioses within a precise phyloge- bootstrap support (78) from the majority of the individual gene netic framework as they are encountered in the clinical micro- partitions and the combined data set and if their monophyly biology laboratory; and (iv) archive a duplicate set of isolates at was not contradicted by analyses of any of the individual single- the CBS-KNAW in Europe and the ARS (NRRL) Culture gene partitions. Collection in the United States that is readily accessible to Although GCPSR-based studies have revealed extensive various research groups wanting to pursue further research on cryptic speciation across the phylogenetic breadth of the genus this topic. This Fusarium database, together with alignments and within other medically (9, 10, 33, 35, 65) and agriculturally and the corrected sequence chromatograms, will be incorpo- important fungi (reviewed in references 21, 80, and 81), the rated into the FUSARIUM-ID database accessible via the level of cryptic speciation was especially pronounced within the Web at Pennsylvania State University (http://isolate Fusarium solani species complex (FSSC) (49, 56, 85) and F. .fusariumdb.org) and the Centraalbureau voor Schimmelcul- incarnatum-F. equiseti species complexes (FIESC) (57). These tures (CBS) Biodiversity Centre (http://www.cbs.knaw.nl two species complexes collectively harbor at least 75 species, /fusarium) to facilitate global identi，cations via the Internet
including 41 associated with mycotic infection of humans and and to promote cooperation and coordination in documenting other animals. Multilocus DNA sequence data have proven to and sharing the diversity and occurrence of clinically relevant be essential for accurately circumscribing species boundaries fusaria.
within Fusarium and also have demonstrated utility in identi-
fying epidemiologically important multilocus haplotypes, such MATERIALS AND METHODS as the widespread F. oxysporum clonal lineage (F. oxysporum Fusarium isolates. The 71 isolates included in this study comprise 69 phylo- species complex 3-a [FOSC 3-a], sequence types [ST] 33, 51, genetically distinct species (Table 1). Of these, 65 were cultured from human and 58) and FSSC 1-a and 2-d, which appear to be common in clinical or veterinary sources. Actual medical or veterinary case isolates were unavailable for three fusaria reported to cause infections in humans, so repre- water systems (43, 54), including those of hospitals, where they sentative isolates of these three species (i.e., F. napiforme, F. sporotrichioides, and pose a signi，cant risk for nosocomial infections (2, 58). F. lateritium) from other sources were used as substitutes. With the exception of Given the importance of fusaria to medicine, veterinary sci- these three species, all of the other isolates have been characterized molecularly ence, and agriculture, it is not surprising that diverse molecular in published studies using partial DNA sequence data (see references in Table methods for their identi，cation have been published. The ma- 1). The isolates included in this study are available upon request from the Agricultural Research Service (NRRL) Culture Collection (http://nrrl.ncaur jority of these methods target the nuclear ribosomal internal .usda.gov/TheCollection/index.html), National Center for Agricultural Utiliza- transcribed spacer (ITS) region (30, 37, 67, 73) or domains D1 tion Research, Peoria, IL, and the CBS-KNAW, where they are stored cryogen- and D2 of the nuclear small-subunit ribosomal DNA (rDNA) ically. (27, 28) as markers. Unfortunately, these methods were devel- Molecular biology. Mycelia were grown in 300-ml Erlenmeyer (asks contain- ing 100 ml of yeast-malt broth (20 g dextrose, 5 g peptone, 3 g yeast extract, and oped in reference to Fusarium morphospecies concepts, which 3 g malt extract per liter; Difco, Detroit, MI) for 2 or 3 days on a rotary shaker greatly underestimate the species diversity reported herein at 100 rpm, harvested over a Bu?chner funnel, and then freeze-dried. Total based on GCPSR. Moreover, rDNA loci are too conserved to genomic DNA was extracted from 100 mg of freeze-dried mycelium using a distinguish many closely related human pathogenic fusaria (8, cetyl trimethyl-ammonium bromide (CTAB; Sigma-Aldrich, St. Louis, MO) pro- 13, 54). Fortunately, recently published multilocus molecular tocol as previously described (50). Portions of the translation elongation factor (EF-1 ) and DNA-directed RNA polymerase second largest subunit (RPB2) phylogenetic studies of Fusarium have revealed that certain were selected based on their demonstrated utility in previous studies (54, 56, 57, protein-encoding genes contain a wealth of phylogenetic signal 85). DNA-directed RNA polymerase subunit 1 (RPB1) was chosen based on (19, 53, 54, 56, 57, 70, 85). It is reasonable to assume that the published species-level studies from the Assembling the Fungal Tree of Life genetic diversity of clinically and veterinarily relevant fusaria (AFTOL) project (18, 42). PCR and sequencing primers used for these three loci are provided in Table 2. Platinum Taq DNA polymerase (Invitrogen, Carlsbad, will continue to expand, whereas phenotypic methods will re- CA) was used in all PCRs which were conducted in an Applied Biosystems (ABI) main woefully inadequate for yielding accurate species-level 9700 thermocycler (Emeryville, CA) using published cycling parameters (50). identi，cations for over two-thirds of the fusaria encountered in Amplicons were size fractionated via gel electrophoresis in 1.5% agarose gels the clinical laboratory. In response to this growing need for (Invitrogen) run in 1 TAE buffer (69), stained with ethidium bromide and then accurate species identi，cation, the present study was initiated photographed over a UV transilluminator. Prior to cycle sequencing, amplicons
3710 O‘DONNELL ET AL. J. CLIN. MICROBIOL.
TABLE 1. Fusaria subjected to DNA MLST
abcgGeographic origin Reference(s) NRRL no. Complex Species Equivalent no. Isolate source or source 44 13604 GFSC F. napiforme CBS 748.97 Millet Namibia 20423 FIESC FIESC 4-a (F. lacertarum) IMI 300797 Lizard skin India 57, 74 20711 FDSC F. penzigii CBS 116508 Human eye Sri Lanka 70 22608 FSSC FSSC 20-a UTHSC 93-1547 Human Massachusetts 56 22611 FSSC FSSC 14-a UTHSC 93-2524 Human eye Michigan 56 25197 FLSC F. cf. lateritium BBA 65687 Bambusa vulgaris Venezuela 46 25229 GFSC F. thapsinum IMI 240460 Human mycetoma Italy 6, 50 d25378 FOSC FOSC clade 3 IMI 214661 Human Oklahoma 4, 51, 58 25387 FOSC FOSC clade 2 ATCC 26225 Human toenail New Zealand 4, 51, 58 25479 FSASC F. sporotrichioides CBS 447.67 Pinus nigra seed Germany 60 e25728 FCOSC F. concolor CBS 463.91 Human Germany 25 26360 FOSC FOSC clade 1 FRC O-0755 Human eye Tennessee 4, 51, 58 26421 GFSC F. nygamai CBS 140.95 Human Egypt 36 28008 FSSC FSSC 29-a CDC B-4701 Human eye Alabama 56 28009 FSSC FSSC 15-a CDC B-5543 Human eye Texas 56 28029 FIESC FIESC 3-b CDC B-3335 Human eye California 57 28541 FSSC FSSC 26-a UTHSC 98-1305 Human Connecticut 56 28546 FSSC FSSC 1-a UTHSC 98-853 Human eye Massachusetts 56 31158 FSSC FSSC 18-a MDA 1 Human Texas 56 31169 FSSC FSSC 25-a MDA 12 Human Texas 56 32309 FSSC FSSC 12-d UTHSC 00-1608 Human Massachusetts 56 32434 FSSC FSSC 16-b (F. lichenicola) CBS 623.92 Human Germany 56, 76 32437 FSSC FSSC 28-a CBS 109028 Human Switzerland 56 32522 FIESC FIESC 18-b Loyola W-14182 Human diabetic cellulitis Illinois 57 32755 FSSC FSSC 9-a FRC S-0452 Turtle Florida 56 32864 FIESC FIESC 17-a FRC R-7245 Human Texas 57 32865 FIESC FIESC 21-b FRC R-8480 Human endocarditis Brazil 57 32866 FIESC FIESC 23-a FRC R-8822 Human cancer patient Texas 57 32868 FIESC FIESC 25-c FRC R-8880 Human blood Texas 57 32997 FIESC FIESC 7-a UTHSC 99-423 Human toenail Colorado 57 34002 FIESC FIESC 22-a UTHSC 95-1545 Human ethmoid sinus Texas 57 34003 FIESC FIESC 20-a UTHSC 95-28 Human sputum Texas 57 34004 FIESC FIESC 16-a UTHSC 94-2581 Human BAL (uid Texas 57 34005 FIESC FIESC 24-a UTHSC 94-2471 Human intravitreal (uid Minnesota 57 34006 FIESC FIESC 15-a UTHSC 93-2692 Human eye Texas 57 34016 FCSC FCSC 2-a UTHSC 98-2537 Human leg Texas 57 34032 FIESC FIESC 5-a UTHSC 98-2172 Human abscess Texas 57 34033 FSASC F. brachygibbosum UTHSC 97-99 Human foot cellulitis Texas 57 34036 FTSC FTSC Fusarium sp. 1 UTHSC 01-1965 Human ethmoid sinus Colorado 57 36140 FDSC F. dimerum CBS 108944 Human blood Netherlands 70 36147 FTSC F. acuminatum CBS 109232 Human bronchial secretion Unknown 57 36160 FDSC F. delphinoides CBS 110140 Human eye Florida 70 36185 FDSC FDSC Fusarium sp. 5 CBS 110312 Human sinus Washington 70 37393 FDSC FDSC Fusarium sp. 2 FRC E-0105 Human eye Sri Lanka 70 37625 FSSC FSSC 27-a CBS 518.82 Human Netherlands 56 43433 FSSC FSSC 2-a CDC 2006011214 Human eye Ohio 56 43441 FSSC FSSC 3 4-a (F. falciforme) CDC 2006743414 Human eye Pennsylvania 56, 76 f43467 FSSC FSSC 8-a (Fusarium sp.) CDC 2006743430 Human eye Louisiana 56 43468 FSSC FSSC 5-a CDC 2006743431 Human eye Iowa 56 43489 FSSC FSSC 6-a CDC 2006743456 Human eye Maryland 56 43498 FIESC FIESC 8-b CDC 2006743466 Human eye Pennsylvania 57 43502 FSSC FSSC 7-a CDC 2006743470 Human eye Tennessee 56 43608 GFSC F. verticillioides UTHSC 03-2552 Human peritoneal (uid Minnesota 7, 75 43610 GFSC F. fujikuroi UTHSC 06-836 Human skin Iowa 11 43617 GFSC F. proliferatum UTHSC 03-60 Human blood Colorado 6, 50, 61, 75 43629 FCSC FCSC 1-b UTHSC 05-3200 Human blood Utah 57 43631 FCSC FCSC 3-a UTHSC 05-2441 Human leg Texas 57 43635 FIESC FIESC 13-a UTHSC 06-638 Horse Nebraska 57 43636 FIESC FIESC 14-c (F. equiseti) UTHSC 06-170 Dog Texas 57 43639 FIESC FIESC 19-a UTHSC 04-135 Manatee Florida 57 43640 FIESC FIESC 1-a UTHSC 04-123 Dog nose Texas 57 43641 FSASC F. armeniacum UTHSC 06-1377 Horse eye Missouri 57 43694 FIESC FIESC 6-a CDC 2006743607 Human eye Texas 57 44901 GFSC F. sacchari SSGH NC1 Human ，nger Italy 6, 24 45999 FTSC F. ;occiferum UTHSC 06-3449 Human scalp California 57 46703 FSSC FSSC 34-a FMR 8281 Nematode Spain 56 46707 FSSC FSSC 35-a FMR 8030 Human eye Brazil 56
Continued on following page
VOL. 48, 2010 MOLECULAR IDENTIFICATION OF HUMAN PATHOGENIC FUSARIA 3711
TABLE 1—Continued
abcgGeographic origin Reference(s) NRRL no. Complex Species Equivalent no. Isolate source or source 31, 45 53131 GFSC F. ananatum SSGH VN Human ，nger Italy 54126 GFSC F. acutatum FMR 8379 Human foot Qatar 79 54147 FTSC FTSC Fusarium sp. 2 CM 3913 Human pericardic (uid Spain 1; this study 54158 GFSC F. subglutinans IUM 96-4102 Human blood Italy 82
a FCSC, Fusarium chlamydosporum species complex; FCOSC, F. concolor species complex; FDSC, F. dimerum species complex; FIESC, Fusarium incarnatum-F. equiseti species complex; FLSC, F. lateritium species complex; FOSC, F. oxysporum species complex; FSASC, F. sambucinum species complex; FSSC, F. solani species complex; FTSC, F. tricinctum species complex; GFSC, Gibberella (Fusarium) fujikuroi species complex. b Arabic numerals identify species within species complexes; lowercase roman letters identify a unique haplotype within species (55, 56). c ATCC, American Type Culture Collection, Manassas, VA; BBA, Biologische Bundesanstalt fu?r Land-und Forstwirtschaft, Institute fu?r Mikrobiologie, Berlin, Germany; CBS-KNAW, Centraalbureau voor Schimmelcultures—Fungal Biodiversity Center, Utrecht, Netherlands; CDC, Centers for Disease Control and Preven- tion, Atlanta, GA; CM, Centro Nacional de Microbiologı?a, Instituto de Salud Carlos III, Madrid, Spain; FMR, Facultat de Medicina i Cie`ncies de la Salut, Reus, Spain; FRC, Fusarium Research Center, The Pennsylvania State University, State College, PA; IMI, CABI Biosciences, Egham, Surrey, England; IUM, Universita` degli Studi di Milano, Milan, Italy; Loyola, Loyola University, Maywood, IL; MDA, M. D. Anderson Cancer Center, Houston, TX; SSGH, Sesto San Giovanni Hospital, Milan, Italy; UTHSC, University of Texas Health Sciences Center, San Antonio, TX. d FOSC clades as reported by O‘Donnell et al. (52). e Reported as Fusarium polyphialidicum, a later synonym of F. concolor (25). f FSSC 8 represents the homothallic species Neocosmospora vasinfecta, which produces an undescribed Fusarium anamorph (49). g BAL, bronchoalveolar lavage.
archived at the Fusarium-ID and CBS-KNAW databases. A conditional combi- were puri，ed using Montage，lter plates (Millipore Corp., Billerica, MA). 96nation approach, which employed maximum parsimony bootstrap values of Sequencing reactions were conducted in a 10- l volume containing 2 l of ABI BigDye Terminator, version 3.1, reaction mixture, 2 to 4 pmol of a sequencing 70% as the threshold for topological discordance, indicated that the three primer, and approximately 50 ng of amplicon as previously described (50). After individual partitions could be analyzed as a combined data set (Table 3). Phy- cycle sequencing, all reaction mixtures were cleaned up using an XTerminator logenetic relationships among the clinically relevant fusaria were inferred from puri，cation kit and then run on an ABI 3730 48-capillary automated sequencer. the combined three-locus data set using unweighted MP implemented in PAUP, Phylogenetic analysis. Sequencher, version 4.9 (Gene Codes, Ann Arbor, MI), version 4.0b10 (78), and maximum likelihood (ML) employing GARLI, version was used to edit and align raw ABI chromatograms, after which the RPB1 and 0.951 (86), as previously described (56). MrModeltest, version 3.8 (64), using the RPB2 alignments were manually edited using TextPad, version 5.1.0 for Windows ModelTest server 1.0, identi，ed the general-time-reversible model with a pro- (Helios Software Solutions; Longridge, United Kingdom). Due to the presence portion of invariant sites and gamma-distributed rate heterogeneity (GTR I ) of a number of length-variable indels within the three introns, sequences from as the best-，t model of nucleotide substitution for the combined data set for the the EF-1 partition were aligned automatically using MAFFT, version 6.0 (http: ML analyses. Searches for the shortest MP trees employed tree bisection and //align.bmr.kyushu-u.ac.jp/mafft/software/), after which 92 ambiguously aligned reconnection (TBR) branch swapping and 1,000 random sequence addition rep- intron nucleotide positions were excluded from the subsequent phylogenetic licates. MP clade support was assessed by nonparametric bootstrapping, employ- analyses. It is important to note that the entire region of EF-1 sequenced is ing 1,000 pseudoreplicates of the data, 10 random addition sequences per rep-
TABLE 2. Primers used for PCR and DNA sequencing bUse Length of Primer Reference(s) Locus Gene product sequence or source aPCR Sequencing Designation Sequence (5 –3 ) obtained (bp)
c EF-1 Translation elongation 639–683EF1 ATGGGTAAGGARGACAAGAC 52 ? factor 1 EF2 GGARGTACCAGTSATCATG 52 ? EF3 GTAAGGAGGASAAGACTCACC 56 ? EF22T AGGAACCCTTACCGAGCTC 52 ?
dRPB1 RNA polymerase largest 1,607 Fa 29 CAYAARGARTCYATGATGGGWC? subunit Benjamin Hall, G2R GTCATYTGDGTDGCDGGYTCDCC ? eunpublished data R8 CAATGAGACCTTCTCGACCAGC This study ? ? F5 ATGGGTATYGTCCAGGAYTC This study F6 CTGCTGGTGGTATCATTCACG This study ? F7 CRACACAGAAGAGTTTGAAGG This study ? F8 TTCTTCCACGCCATGGCTGGTCG This study ? R9 TCARGCCCATGCGAGAGTTGTC This study ? ?
fRPB2 RNA polymerase second 1,700–1,7425f2 GGGGWGAYCAGAAGAAGGC 68 ? ? largest subunit 7cr CCCATRGCTTGYTTRCCCAT 39 ? ? 7cf ATGGGYAARCAAGCYATGGG 39 ? ? 11ar GCRTGGATCTTRTCRTCSACC 39 ? ?
aA, G or T; R A or G; S C or G; W A or T; Y C or T. Db ?, primer was used for indicated purpose. RPB1 PCR primer G2R was designed by Benjamin Hall (http://faculty.washington.edu/benhall/). c The partial EF-1 sequence size range. d Fa is identical to RPB1-DF2asc (29), except that the 3 -most nucleotide was deleted. e http://faculty.washington.edu/benhall/people.html. f The size difference is due to 3-bp and 39-bp inserts in 5 7 RPB2 fragment in members of the Fusarium dimerum species complex and the Gibberella clade, respectively.
3712 O‘DONNELL ET AL. J. CLIN. MICROBIOL.
TABLE 3. Tree statistics for the individual and combined partitions
abcdeLocus No. of bp PIC AUT No. of MPTs MPT length CI RI PIC/no. of bp f632 284 0.45 43 10,000 1,183 0.47 0.869 EF-1 RPB1 1,607 603 0.38 52 24 2,590 0.34 0.851 gRPB2 5 7 882 379 0.43 26 13 1,475 0.43 0.879 hRPB2 7 11 860 265 0.31 30 618 1,272 0.35 0.83 RPB2 5 7 and 7 11 1,742 644 0.37 56 1,000 2,789 0.39 0.855 RPB1 RPB2 3,349 1,247 0.37 108 1 5,447 0.38 0.85 EF-1 RPB1 RPB2 3,981 1,531 0.38 151 4 6,683 0.4 0.852
a PIC, parsimony-informative character (i.e., shared derived nucleotide position or synapomorphy). b AUT, autapomorphy or a derived character unique to a particular taxon (i.e., not parsimony informative). c MPT, most parsimonious tree (i.e., shortest tree inferred from the DNA sequence data). d CI, consistency index. This index provides a metric of how much noise is in a data set. The CI is calculated by dividing the minimum possible number of steps by the observed number of steps. e RI, retention index. Like the CI, this metric provides a measure of how much noise is in a data set. Unlike the CI, the RI measures the amount of parsimony-informative characters from a data set that are re(ected in the phylogenetic tree. f Ninety-two ambiguously aligned positions were excluded from the EF-1 partition. g Region PCR ampli，ed by primers 5f2 and 7cr (Table 2). h Region PCR ampli，ed by primers 7cf and 11ar (Table 2).
licate, and TBR branch swapping. Nonparametric ML bootstrapping was reports of F. sporotrichioides (60) and F. lateritium (46) as conducted with a 2.6-GHz MacBook Pro, using 5,000 generations without im- etiological agents of fusarioses to be tentative because these proving the topology parameter and 1,000 ML pseudoreplicates of the data. identi，cations were not supported by molecular data and be- Nucleotide sequence accession numbers. DNA sequences have been deposited cause these isolates were unavailable for further study. The in GenBank under accession numbers HM347114 to HM347221. morphological concepts of both species are known to comprise multiple phylogenetic species (20; K. O‘Donnell, unpublished RESULTS AND DISCUSSION data). If identi，cation of haplotypes within a species is re- The primary objective of this study was to develop a Web- quired, detailed information on additional loci to sequence has accessible three-locus DNA sequence database to facilitate previously been published (34, 51, 56, 57, 71, 85). NEXUS ，les
identi，cation of fusaria associated with human and animal with a PAUP block used to develop the FSSC, FIESC, F.
infections. Additionally, the utility of single- and multilocus chlamydosporum species complex (FCSC), F. dimerum species
DNA sequence data for accurately identifying clinically impor- complex (FDSC), and Gibberella fujikuroi species complex
tant fusaria and a duplicate set of isolates at the CBS-KNAW (GFSC) can be downloaded from the Internet-accessible in Europe and the ARS (NRRL) Culture Collection in the Fusarium database sites cited above or accessed via the dedi- United States is described. cated BLAST servers.
PCR primers Fa and G2R, which were designed for higher- Phylogenetic relationships and identi；cation of human
level phylogenetics as part of the AFTOL project (Table 2), pathogenic fusaria. The database was populated with aligned
partial sequences from the nuclear genes RPB1 (1,607 sites), successfully ampli，ed an 1,894-bp fragment from the RPB1
RPB2 (1,742 sites), and EF-1 (632 sites) from 71 isolates D-to-G region in all of the fusaria included in the database representing 69 fusariosis-associated species reported in the except for F. cf. lateritium NRRL 25197. The Fa and G2R
literature (Table 1). Sequences of F. sporotrichioides and F. primer sites in this isolate, however, appear to be conserved, lateritium were included in the database, with the caveat that based on DNA sequence analysis of overlapping fragments the single reports of these species causing infections in humans obtained using Fa/R8 and F7/R9 as PCR primers (Fig. 1). need to be veri，ed. Although F. napiforme has clearly been Because DNA sequence data from the RPB1 locus had not
shown to cause a human mycotic infection (44), we consider been used previously for Fusarium phylogenetics, the design of
FIG. 1. Map of the RNA polymerase largest-subunit (RPB1) locus. Location and orientation of PCR and sequencing primers are indicated by half-arrows. PCR primers Fa and G2R (Table 2) successfully ampli，ed an 1,894-bp fragment in all of the isolates except for NRRL 25197 Fusarium cf. lateritium, even though the PCR primer sites appear to be conserved in this isolate. Therefore, the Fa G2R region was ampli，ed in this isolate as two overlapping fragments using the PCR primer pairs Fa/R8 (1,127 bp) and F7/R9 (2,217 bp). Primers F5 and G2R (ank the 1,607-bp RPB1 D-to-G region that was sequenced and analyzed. Sequences for 65 of the 71 isolates were generated using the F5, F7, and F8 sequencing primers. See Fig. 1 in Matheny et al. (41) for a detailed map of the entire RPB1 locus showing the position of the D-to-G region.
VOL. 48, 2010 MOLECULAR IDENTIFICATION OF HUMAN PATHOGENIC FUSARIA 3713
internal sequencing primers was accomplished by downloading (79% BS) as a sister to the ((FCSC, F. sambucinum species
complex [FSAMSC]) FIESC) clade in the ML analysis, but this sequences of this gene from the three sequenced fusarial ge-
relationship was not supported by MP bootstrapping (51% nomes (F. graminearum, F. oxysporum, and F. verticillioides) at
BS). Close to three-quarters of the medically relevant Fusar- the Broad Institute of MIT and Harvard University (http:
//www.broadinstitute.org/annotation/genome/fusarium_group ium species were nested within the following three species
complexes: FSSC (n 21), FIESC (n 20), and GFSC (n /MultiHome.html) and the genome of F. solani f. sp. pisi
10). Of these, members of the FSSC are by far the most /Nectria haematococca from the Department of Energy Joint
Genome Institute (JGI) (http://genome.jgi-psf.org/Necha2 important, accounting for approximately 50 to 60% of all /Necha2.home.html). As reported for other ，lamentous asco- fusarioses worldwide (5, 56, 85).
mycetes (26), the RPB1 D-to-G region in Fusarium was entirely Web-based identi；cation of human pathogenic fusaria. The
exonic and free of indels. Alignment of the four RPB1 se- database described in this paper is accessible via the Web in quences facilitated the design of ，ve conserved internal se- two forms with different features, either of which can be used quencing primers (Fig. 1). However, only three were needed for routine identi，cation, and housed and maintained at Penn- (i.e., F5, F7, and F8) to obtain reliable sequence coverage of 66 sylvania State University (http://isolate.fusariumdb.org) and at of the 71 fusaria included in this study. Two additional primers the CBS Fungal Biodiversity Center (http://www.cbs.knaw.nl (i.e., F6 and Fa) were required to completely sequence the /fusarium). FUSARIUM-ID was originally set up in 2004 (19) D-to-G region in members of the F. dimerum species complex as the ，rst dedicated website for the molecular identi，cation of
(FDSC) and F. fujikuroi NRRL 43610. Alignment of the RPB2 fusaria using a partial EF-1 gene sequence of an unknown as
region between primers F5 and F7 required the insertion of the query to BLAST the database. Construction of the two indels 3 and 39 bps in length to accommodate 1 and 13 FUSARIUM-ID database was motivated in part to ensure that additional codons, respectively, within members of the FDSC researchers could use sequence data to make connections be- and the Gibberella clade. By way of contrast, due to the pres- tween their isolates of interest and sequence-characterized iso- ence of three length-variable introns, we employed the soft- lates available in public culture collections. This is essential ware program MAFFT (http://align.bmr.kyushu-u.ac.jp/mafft because queries of GenBank (http://blast.ncbi.nlm.nih.gov /software/) to align the EF-1 region. To obtain an alignment /Blast.cgi) consistently recovered Fusarium sequences that
of the EF-1 region that re(ected positional homology, 92 were incorrectly identi，ed (discussed in reference 63). For the intron nucleotide positions were coded as ambiguously aligned latter reason, researchers who choose to access the data gener- and excluded from all subsequent phylogenetic analyses. ated in the present study via GenBank are advised to look at the The three-locus data set totaled 3,981 bp of aligned DNA top sequences sorted by maximum identity (―Max ident‖) pro-
sequence data, including 1,531 parsimony-informative nucleo- ducing signi，cant alignments, to make sure that the organism tide positions. Summary sequence and tree statistics for the name is used consistently. FUSARIUM-ID has been updated individual and combined data sets indicated that the three loci with new data search and visualization tools (S. Kang, unpub- contained very similar levels of parsimony-informative charac- lished data) and currently archives multilocus DNA sequence ters (PIC) per bp of sequence (Table 3). The best ML tree, data from selected species, including the broad spectrum of med- based on 10 independent analyses of the concatenated data set, ically important fusaria, and sequence data from most previously yielded a log likelihood of 38,129.37 (Fig. 2). The four most- published studies will be uploaded into FUSARIUM-ID. Expan- parsimonious trees were 6,683 steps in length and differed only sion of FUSARIUM-ID should greatly facilitate accurate in minor rearrangements of four closely related phylogenetic species identi，cations, especially in light of the fact that at species within the FIESC (19, 22–24) and members of the least two-thirds (46/69) of the human pathogenic species FOSC (Table 3). Because the root position of the tree is cannot be identi，ed currently using morphological data. unknown (54), the trees were midpoint rooted. Irrespective of Using the FUSARIUM-ID database. A Web-accessible
whether trees were midpoint rooted or rooted using sequences user‘s guide to FUSARIUM-ID can be found at the following of the FDSC or FSSC as a sister to the ingroup, the root always link: http://isolate.fusariumdb.org/guide.php. The updated joined the tree with F. cf. lateritium NRRL 25197 forming the FUSARIUM-ID database discussed here can be queried via most basal divergence within a strongly supported (100% boot- the BLAST feature using sequence data or by other informa- strap support [BS]) Gibberella clade (Fig. 2). ML and MP tion associated with isolates, including host or substrate of phylogenetic analyses of the concatenated data set recovered origin, geographic origin, and accession numbers from other trees that were highly concordant topologically (Fig. 2; only the culture collections. We recommend using one of the three loci best ML tree is shown). Evolutionary relationships among the highlighted in this paper (EF-1 , RPB1, or RPB2) ，rst because
six informally named species complexes within the Gibberella of their relatively complete coverage of human pathogenic clade were fully resolved by ML bootstrapping. ML and MP fusaria.
bootstrapping recovered similar levels of clade support, with Also available are the DNA sequence alignments used in the two exceptions. One of these involved the monophyly of the various published multilocus phylogenetic and identi，cation
GFSC and its three biogeographically structured subclades studies that are the basis for this database (49–59, 70, 85).
(50). Although the GFSC and its three subclades were strongly Additional tools for manipulating DNA sequence data and supported by ML bootstrapping (Fig. 2), as were the previously for visualization of geographic distribution of isolates are inferred (American (Asian, African)) evolutionary relation- available, as they are for the Phytophthora plant pathogen
ships of the subclades (50), only the American clade received database (62). The Biolomics software package, utilized in the strong MP bootstrap support. In the second exception, the F. CBS strain database (http://www.cbs.knaw.nl/fungi/BioloMICS tricinctum species complex (FTSC) received moderate support .aspx?searchopt 4), provides a wide array of additional tools,
3714 O‘DONNELL ET AL. J. CLIN. MICROBIOL.
FIG. 2. Best maximum likelihood tree inferred from the combined three-locus data set for 71 isolates representing 69 medically and veterinarily important Fusarium species. Because the branching order of the two most basal lineages, the F. solani and F. dimerum species complexes (FSSC and FDSC), was unresolved in more inclusive analyses (54), the phylogram was midpoint rooted. The Gibberella clade contains the six most derived, clinically relevant species complexes. Species and their multilocus haplotypes are identi，ed by Arabic numbers and lowercase Roman letters, respectively, for members of the Fusarium incarnatum-F. equiseti species complex (FIESC), the F. chlamydosporum species complex (FCSC), and the FSSC as previously reported (56, 57). Numbers in parentheses by the three F. oxysporum species complex (FOSC) isolates refer to clades as reported by O‘Donnell et al. (50). Note that Latin binomials can be applied with con，dence to only 23 of the 69 species. Fusarium sporotrichioides and F. cf. lateritium are highlighted in gray to indicate that reports of these species causing human infections need to be con，rmed. Numbers above internodes represent ML bootstrap values based on 1,000 pseudoreplicates of the data. MP bootstrap values are indicated below internodes only when they differed by 5% of the MP value. Af, African subclade; Am, American subclade; As, Asian subclade; FSAMSC, F. sambucinum species complex; FTSC, F. tricinctum species complex; and GFSC, Gibberella fujikuroi species complex.
VOL. 48, 2010 MOLECULAR IDENTIFICATION OF HUMAN PATHOGENIC FUSARIA 3715
including simultaneous searches with multiple loci utilizing the problems in using this locus for phylogenetics and identi，-
cation of fusaria. ―multiple sequences‖ tool and searches against all of the ac-
A single-locus sequence query to the database may provide cession numbers within the entire CBS fungal culture collec-
exact matches to isolates of one or more multilocus sequence tion.
types (MLSTs) de，ned in previous studies. Users are re- Interpreting the results. We anticipate that clinical micro-
minded that such an exact match re(ects only the single locus biologists with access to DNA sequencing technology will uti-
used as a query; their isolate of interest may differ from the lize this database for identi，cation of isolates to the species
level, often using a single DNA marker (generally EF-1 , MLST matches at other loci and thus not ，t into that MLST as
RPB1, or RPB2) in doing so. In the context of other informa- heretofore de，ned. As discussed previously (19), when a query tion, data from a single locus is often but not always suf，cient sequence does not perfectly match anything in the database, to provide a reasonably high-con，dence identi，cation. The the unknown may represent a novel allele of a species in the utility of a sequence match result depends on a variety of database or a novel Fusarium species. For the majority of the factors, including the quality of the sequence being used as a queries, it is reasonable to assume that the unknown sequence query, the degree to which the diversity of fusaria are repre- represents a novel allele of a species represented in the data- sented in the database, and the various levels of known and base, given the database‘s dense taxon sampling. Assuming
actual DNA sequence diversity within species. All results must that this is the case, then the top match or matches should be interpreted with care, and precise conclusions may require con，rm that the variant allele is nested within a species previ- additional data and analyses, including phylogenetic analysis. ously characterized by GCPSR. However, when the unknown Prior to conducting BLAST searches, it is essential that appears to be closely related to more than one species in the the sequences be edited using a software program such as database, we recommend that additional sequence data be DNA Chromatogram Explorer Lite (freeware available generated to take advantage of the wealth of multilocus DNA from HeracleSoftware, Lilienthal, Germany) or Sequencher sequence data generated in published GCPSR-based studies of (Gene Codes, Ann Arbor, MI) to trim low-quality ends and the FDSC (70), FSSC (49, 56, 85), FOSC (51, 58), GFSC (50), reconcile any differences between overlapping sequences. FCSC, and FIESC (57). Though representatives of the FTSC Whether using a partial EF-1 , RPB1, or RPB2 gene se- and FSAMSC are included in the current database, they are quence as the query, an exact match to one of the human very rarely encountered as etiologic agents of fusarioses (57). If pathogenic species in the FUSARIUM-ID database gener- the BLAST results indicate that the query sequence represents ally can be interpreted as de，nite species-level identi，ca- a novel species not currently represented in FUSARIUM-ID, tion. It is important for researchers to be aware, however, then the test isolate‘s genealogical exclusivity should be eval- that several plant-pathogenic Fusarium species, including uated via GCPSR analyses, using the appropriate multilocus those that cause economically devastating diseases, such as typing scheme and including two or more isolates, if available, fusarium head blight (FHB) of cereals (FSAMSC) (53, 59, to assess their monophyly via bootstrapping. In practice, we 84) and soybean sudden death syndrome (SDS) (FSSC) (55) recognize such isolates as phylogenetically distinct species only cannot be distinguished using DNA sequences of the three if they are resolved as reciprocally monophyletic in the major- genes included in FUSARIUM-ID. For this reason, it is ity of the bootstrapped individual gene partitions, as well as in prudent to check the top sequences producing signi，cant the combined data set, and their monophyly is not contradicted alignments to make sure that two or more species do not by bootstrapping of any individual partition (14, 56, 57). share the same allele. In addition to the FHB and SDS While some phylogenetic species are known to possess little fusaria noted above, this problem may be encountered with or no allelic variation within the major diagnostic markers a small number of clinically relevant species within the employed, others are far more variable. Isolates of F. prolif-
FSSC and FIESC. In anticipation of this problem, published eratum, for example, may differ by as much as 2.1% at the sequence data comprising the three-locus typing schemes EF-1 locus and 1.7% at the RPB2 locus (D. M. Geiser and K.
(EF-1 , RPB2, and ITS large subunit [LSU] rDNA) for O‘Donnell, unpublished data). In most cases, a moderately these two complexes (56, 57) have been incorporated into divergent, single-locus best match (e.g., 96 to 98% identity at the FUSARIUM-ID database. It should be noted that, com- the EF-1 locus) would likely represent a species that is not pared to the partial EF-1 , RPB1, and RPB2 gene se- represented in the database, but data from additional loci and quences, the ITS LSU rDNA possesses relatively little phy- phylogenetic analyses would be necessary to determine that. logenetic signal within Fusarium (8, 54). Although the ITS It is worth mentioning that the current version of FUSAR- rDNA region has been adopted widely by the fungal com- IUM-ID possesses notable similarities and differences with munity as the universal locus for DNA barcoding of fungi TrichoKEY (http://www.isth.info/tools/molkey/index.php), a (72), use of this marker within Fusarium for inferring evo- Web-accessible site dedicated to identi，cation of Trichoderma
lutionary relationships is complicated by the presence of spp. (16). Like FUSARIUM-ID, TrichoKEY provides a ITS2 paralogs (origin by gene duplication) or xenologs (or- BLAST function to identify unknowns using DNA sequence igin by horizontal gene transfer) whose phylogenetic distri- data. FUSARIUM-ID has been updated to incorporate two bution does not track with the species phylogeny (50). Sim- useful features of TrichoKEY: (i) BLAST queries using three- ilarly, the discovery of highly divergent paralogs and low locus DNA sequence data and (ii) the ability to download sequence divergence among orthologs of the mitochondrial sequence alignments for subsequent phylogenetic analyses. cytochrome oxidase 1 gene in Fusarium (23), a locus widely These two databases differ primarily in that ITS rDNA has promoted for barcoding diverse organisms (http://www been reported to be more useful than partial EF-1 and RPB2
.barcoding.si.edu/DNABarCoding.htm), indicates potential sequences for identi，cations within Trichoderma (12, 32),
3716 O‘DONNELL ET AL. J. CLIN. MICROBIOL.
Dannaoui, J. Guarro, G. Haase, C. C Kibbler, W. Meyer, K. O’Donnell, C. A. whereas EF-1 , RPB1, and RPB2 appear to contain roughly Petti, J. L. Rodriguez-Tudela, D. Sutton, A. Velegraki, and B. L. Wickes. equal levels of phylogenetic signal useful for species-level iden- 2009. Sequence-based identi，cation of Aspergillus, Fusarium, and Mucorales ti，cations within Fusarium. We also point out that the 5-to-7 species in the clinical mycology laboratory: where are we and where should we go from here? J. Clin. Microbiol. 47:877–884. region of RPB2 often can be used alone, without including 9. Balajee, S. A., J. Houbraken, P. E. Verweij, S.-B. Hong, T. Yaghuchi, J. sequence data from the 7-to-11 region, to identify an unknown Varga, and R. A. Samson. 2007. Aspergillus species identi，cation in the to the species level. clinical setting. Stud. Mycol. 59:39–46. 10. Bovers, M., F. Hagen, E. E. Kuramae, and T. Boekhout. 2008. Six mono- The utility of the fusariosis-associated portion of the phyletic lineages identi，ed within Cryptococcus neoformans and Cryptococcus FUSARIUM-ID data set is expected to grow as new validated gattii by multi-locus sequence typing. Fungal Genet. Biol. 45:400–421. sequences/sequence chromatograms and cultures are acces- 11. Chang, D. C., G. B. Grant, K. O’Donnell, K. A. Wannemuehler, J. Noble- Wang, C. Y. Rao, L. M. Jacobson, C. S. Crowell, R. S. Sneed, F. M. T. Lewis, sioned, especially as researchers and journals recognize the J. K. Schaffzin, M. A. Kainer, C. A. Genese, E. C. Alfonso, D. B. Jones, A. necessity for molecularly based identi，cations of fusarial Srinivasan, S. K. Fridkin, and B. J. Park. 2006. A multistate outbreak of pathogens. The Web-accessible FUSARIUM-ID database and Fusarium keratitis associated with use of a contact lens solution. JAMA 296:953–963. the CBS database will continue to be updated with phyloge- 12. Chaverri, P., and G. J. Samuels. 2004. Hypocrea/Trichoderma (Ascomycota, netically diverse partial EF-1 , RPB1, and RPB2 sequences, Hypocreales, Hypocreaceae): species with green ascospores. Stud. Mycol. 48:1–116. thereby enabling researchers to accurately identify virtually all 13. Clinical and Laboratory Standards Institute. 2008. Interpretive criteria for unknowns to the species level, as well as allowing them to microorganism identi，cation by DNA target sequencing; proposed guide- precisely place novel pathogens within a robust phylogenetic line. CLSI document MM18-A. Clinical and Laboratory Standards Institute, Wayne, PA. framework. Molecular phylogenetic clari，cation of human op- 14. Dettman, J. R., D. J. Jacobson, and J. W. Taylor. 2003. A multilocus gene- portunistic fusarial species limits represents a signi，cant con- alogical approach to phylogenetic species recognition in the model eukaryote ceptual and technological advance, which should help facilitate Neurospora. Evolution 57:2703–2720. 15. Dignani, M. C., and E. Anaissie. 2004. Human fusariosis. Clin. Microbiol. the long-term goals of epidemiologic studies directed at iden- Infect. 10(Suppl. 1):67–75. tifying the spectrum of etiologic agents and their environmen- 16. Druzhinina, I. S., A. G. Kopchinskiy, M. Komon?, J. Bissett, G. Szakacs, and tal reservoirs, especially among hospitalized patients at great- C. P. Kubicek. 2005. An oligonucleotide barcode for species identi，cation in Trichoderma and Hypocrea. Fungal Genet. Biol. 42:813–828. est risk for acquiring nosocomial infections. Through the 17. Espinel-Ingroff, A., V. Chaturvedi, A. Fothergill, and M. G. Rinaldi. 2002. elucidation of species boundaries in the human-pathogenic Optimal testing conditions for determining MICs and minimum fungicidal fusaria, it should be possible to develop DNA sequence-inde- concentrations of new and established antifungal agents for uncommon molds: NCCLS collaborative study. J. Clin. Microbiol. 40:3776–3781. pendent methods for their rapid identi，cation, such as micro- 18. Frøslev, T. G., P. B. Matheny, and D. S. Hibbett. 2005. Lower level relation- sphere (54, 55, 84) and oligonucleotide arrays (30). ships in the mushroom genus Cortinarius (Basidiomycota, Agaricales): a comparison of RPB1, RPB2, and ITS phylogenies. Mol. Phylogenet. Evol. 37:602–618. ACKNOWLEDGMENTS 19. Geiser, D. M., M. del M. Jime?nez-Gasco, S. Kang, I. Makalowska, N. Veer- Special thanks are due to Stacy Sink and Jean H. Juba for excellent araghavan, T. J. Ward, N. Zhang, G. A. Kuldau, and K. O’Donnell. 2004. FUSARIUM-ID v. 1.0: a DNA sequence database for identifying Fusarium. technical assistance, Nathane Orwig for generating the DNA se- Eur. J. Plant Pathol. 110:473–479. quences in NCAUR‘s DNA core facility, and the culture collections 20. Geiser, D. M., M. L. L. Ivey, G. Hakiza, J. H. Juba, and S. A. Miller. 2005. and individuals who supplied isolates used in this study. Gibberella xylarioides (anamorph: Fusarium xylarioides), a causative agent of The mention of trade products or ，rm names does not imply that coffee wilt disease in Africa, is a previously unrecognized member of the G. they are recommended by the U.S. Department of Agriculture over fujikuroi species complex. Mycologia 97:191–201. similar products or other ，rms not mentioned. In addition, the ，ndings 21. Geiser, D. M., J. I. Pitt, and J. W. Taylor. 1998. Cryptic speciation and and conclusions in this article are those of the author(s) and do not recombination in the a(atoxin-producing fungus Aspergillus ;avus. Proc. necessarily represent the views of the CDC. Natl. Acad. Sci. U. S. A. 95:388–393. 22. Gerlach, W., and H. Nirenberg. 1982. The genus Fusarium—a pictorial atlas. REFERENCES Mitt. Biol. Bundesanst. Land-Forstwirtsch. Berlin-Dahlem 209:1–406. 23. Gilmore, S. R., T. Gra?fenhan, G. Louis-Seize, and K. A. Seifert. 2009. 1. Alastruey-Izquierdo, A., M. Cuenca-Estrella, A. Monzo?n, E. Mellado, and Multiple copies of cytochrome oxidase I in species of the fungal genus J. L. Rodríguez-Tudela. 2008. Antifungal susceptibility pro，le of clinical Fusarium. Mol. Ecol. Res. 9(Suppl. 1):90–98. Fusarium spp. isolates identi，ed by molecular methods. J. Antimicrob. Che- 24. Guarro, J., M. Nucci, T. Akiti, J. Gene?, M. D. G. C. Barreiro, and R. T. mother. 61:805–809. Gonc?alves. 2000. Fungemia due to Fusarium sacchari in an immunosup- 2. Anaissie, E. J., R. T. Kuchar, J. H. Rex, A. Francesconi, M. Kasai, F.-M. C. pressed patient. J. Clin. Microbiol. 38:419–421. Mu?ller, M. Lozano-Chiu, R. C. Summerbell, M. C. Dignani, S. J. Chanock, 25. Guarro, J., C. Rubio, J. Gene?, J. Cano, J. Gil, R. Benito, M. J. Moranderia, and T. J. Walsh. 2001. Fusariosis associated with pathogenic Fusarium spe- and E. Miguez. 2003. Case of keratitis caused by an uncommon Fusarium cies colonization of a hospital water system: a new paradigm for the epide- species. J. Clin. Microbiol. 41:5823–5826. miology of opportunistic mold infections. Clin. Infect. Dis. 33:1871–1878. 26. Gueidan, C., C. R. Villasen?or, G. S. de Hoog, A. A. Gorbushina, W. A. 3. Arikan, S., M. Lozano-Chiu, V. Paetznick, S. Nangia, and J. H. Rex. 1999. Untereiner, and F. Lutzoni. 2008. A rock-inhabiting ancestor for mutualistic Microdilution susceptibility testing of amphotericin B, itraconazole, and and pathogen-rich fungal lineages. Stud. Mycol. 61:111–119. voriconazole against clinical isolates of Aspergillus and Fusarium species. 27. Hall, L., S. Wohl；el, and G. D. Roberts. 2004. Experience with the MicroSec J. Clin. Microbiol. 37:3946–3951. D2 large-subunit ribosomal DNA sequencing kit for identi，cation of ，la- 4. Azor, M., J. Cano, J. Gene?, and J. Guarro. 2009. High genetic diversity and mentous fungi encountered in the clinical laboratory. J. Clin. Microbiol. poor in vitro response to antifungals of clinical strains of Fusarium oxyspo- 42:622–626. rum. J. Antimicrob. Chemother. 63:1152–1155. 28. Hennequin, C., E. Abachin, F. Symoens, V. Lavarde, G. Reboux, N. Nolard, 5. Azor, M., J. Gene?, J. Cano, and J. Guarro. 2007. Universal in vitro antifungal and P. Berche. 1999. Identi，cation of Fusarium species involved in human resistance of genetic clades of the Fusarium solani species complex. Antimi- infections by 28S rRNA gene sequencing. J. Clin. Microbiol. 37:3586–3589. crob. Agents Chemother. 51:1500–1503. 29. Hofstetter, V., J. Miadlikowska, F. Kauff, and F. Lutzoni. 2007. Phylogenetic 6. Azor, M., J. Gene?, J. Cano, P. Manikandan, N. Venkatapathy, and J. Guarro. comparison of protein-coding versus ribosomal RNA-coding sequence data: 2009. Less-frequent Fusarium species of clinical interest: correlation between a case study of the Lecanoromycetes (Ascomycota). Mol. Phylogenet. Evol. morphological and molecular identi，cation and antifungal susceptibility. 44:412–426. J. Clin. Microbiol. 47:1463–1468. 30. Hsiao, C. R., L. Huang, J.-P. Bouchara, R. Barton, H. C. Li, and T. C. Chang. 7. Azor, M., J. Gene?, J. Cano, D. A. Sutton, A. W. Fothergill, M. G. Rinaldi, and J. Guarro. 2008. In vitro antifungal susceptibility and molecular character- 2005. Identi，cation of medically important molds by an oligonucleotide array. J. Clin. Microbiol. 43:3760–3768. ization of clinical isolates of Fusarium verticillioides (Fusarium moniliforme) and Fusarium thapsinum. Antimicrob. Agents Chemother. 52:2228–2231. 31. Jacobs, A., P. S. van Wyk, W. F. O. Marasas, B. D. Wing；eld, M. J. Wing- 8. Balajee, S. A., A. M. Borman, M. E. Brandt, J. Cano, M. Cuenca-Estrella, E. ；eld, and T. A. Coutinho. 2010. Fusarium ananatum sp. nov. in the Gibberella
VOL. 48, 2010 MOLECULAR IDENTIFICATION OF HUMAN PATHOGENIC FUSARIA 3717
fujikuroi species complex from pineapples with fruit rot in South Africa. 55. O’Donnell, K., S. Sink, M. M. Scandiani, A. Luque, A. Colletto, M. Biasoli, M., L. Lenzi, G. Salas, V. Gonza?lez, L. D. Ploper, N. Formento, R. N. Pioli, Fungal Biol. 114:515–527. T. Aoki, X. B. Yang, and B. A. J. Sarver. 2010. Soybean sudden death 32. Jaklitsch, W. M. 2009. European species of Hypocrea part I. The green- syndrome species diversity within North and South America revealed by spored species. Stud. Mycol. 63:1–91. 33. Kasuga, T., T. J. White, G. Koenig, J. McEwen, A. Restrepo, E. Castan?eda, multilocus genotyping. Phytopathology 100:58–71. C. da Silva Lacaz, E. M. Heins-Vaccari, R. S. de Freitas, R. M. Zancope?- 56. O’Donnell, K., D. A. Sutton, A. Fothergill, D. McCarthy, M. G. Rinaldi, Oliveira, Z. Qin, R. Negroni, D. A Carter, Y. Mikami, M. Tamura, M. L M. E. Brandt, N. Zhang, and D. M. Geiser. 2008. Molecular phylogenetic Taylor, G. F. Miller, N. Poonwan, and J. W. Taylor. 2003. Phylogeography of diversity, multilocus haplotype nomenclature, and in vitro antifungal resis- the fungal pathogen Histoplasma capsulatum. Mol. Ecol. 12:3383–3401. tance within the Fusarium solani species complex. J. Clin. Microbiol. 46: 34. Kiehn, T. E., P. E. Nelson, E. M. Bernard, F. F. Edwards, B. Koziner, and D. 2477–2490. Armstrong. 1985. Catheter-associated fungemia caused by Fusarium chlamy- 57. O’Donnell, K., D. A. Sutton, M. G. Rinaldi, C. Gueidan, P. W. Crous, and dosporum in a patient with lymphocytic lymphoma. J. Clin. Microbiol. 21: D. M. Geiser. 2009. Novel multilocus sequence typing scheme reveals high 501–504. genetic diversity of human pathogenic members of the Fusarium incarna- 35. Koufopanou, V., A. Burt, and J. W. Taylor. 1997. Concordance of gene tum-F. equiseti and F. chlamydosporum species complexes within the United genealogies reveals reproductive isolation in the pathogenic fungus Coccid- States. J. Clin. Microbiol. 47:3851–3861. ioides immitis. Proc. Natl. Acad. Sci. U. S. A. 94:5478–5482. 58. O’Donnell, K., D. A. Sutton, M. G. Rinaldi, K. C. Magnon, P. A. Cox, S. G. Revankar, S. Sanche, D. M. Geiser, J. H. Juba, J.-A. H. van Burik, A. 36. Krulder, J. W. M., R. W. Brimicombe, P. W. Wijermans, and W. Gams. 1996. Padhye, E. J. Anaissie, A. Francesconi, T. J. Walsh, and J. S. Robinson. 2004. Systemic Fusarium nygamai infection in a patient with lymphoblastic non- Hodgkin‘s lymphoma. Mycoses 39:121–123. Genetic diversity of human pathogenic members of the Fusarium oxysporum 37. Landlinger, C., S. Preuner, B. Willinger, B. Haberpursch, Z. Racil, J. Mayer, complex inferred from multilocus DNA sequence data and ampli，ed frag- and T. Lion. 2009. Species-speci，c identi，cation of a wide range of clinically ment length polymorphism analyses: evidence for the recent dispersion of a relevant fungal pathogens by use of Luminex xMAP technology. J. Clin. geographically widespread clonal lineage and nosocomial origin. J. Clin. Microbiol. 47:1063–1073. Microbiol. 42:5109–5120. 38. Leslie, J. F., and B. A. Summerell. 2006. The Fusarium laboratory manual. 59. O’Donnell, K., T. J. Ward, D. M. Geiser, H. C. Kistler, and T. Aoki. 2004. Blackwell Publishing, Ames, IA. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct 39. Liu, Y. J., S. Whelen, and B. D. Hall. 1999. Phylogenetic relationships among species within the Fusarium graminearum species complex. Fungal Genet. ascomycetes: evidence from an RNA polymerase II subunit. Mol. Biol. Evol. Biol. 41:600–623. 16:1799–1808. 60. O? zyurt, M., N. Ardic?, K. Turan, çS. Yildiz, O. O? zyaral, U. Demirpek, T. 40. Marasas, W. F. O., P. E. Nelson, and T. A. Toussoun. 1984. Toxigenic Haznedarog?lu, and T. Yurdun. 2008. The isolation of Fusarium sporotri- Fusarium species: identity and mycotoxicology. Pennsylvania State Univer- chioides from a diabetic foot wound sample and identi，cation. Marmara sity Press, University Park, PA. Med. J. 21:68–72. 41. Matheny, P. B., Y. J. Liu, J. F. Ammirati, and B. D. Hall. 2002. Using RPB1 61. Palmore, T. N., Y. R. Shea, R. W. Childs, R. M Sherry, and T. J. Walsh. 2010. sequences to improve phylogenetic inference among mushrooms (Inocybe, Fusarium proliferatum soft tissue infection at the site of plant trauma: recov- Agaricales). Am. J. Bot. 89:688–698. ery, isolation, and direct molecular identi，cation. J. Clin. Microbiol. 48:338– 42. Matheny, P. B. 2005. Improving phylogenetic inference of mushrooms with 341. RPB1 and RPB2 nucleotide sequences (Inocybe; Agaricales). Mol. Phylo- 62. Park, J., B. Park, N. Veeraraghavan, K. Jung, Y.-H. Lee, J. E. Blair, D. M. genet. Evol. 35:1–20. Geiser, S. Isard, M. A. Mans；eld, E. Nikolaeva, S.-Y. Park, J. Russo, S. H. 43. Mehl, H. L., and L. Epstein. 2007. Fusarium solani species complex isolates Kim, M. Greene, K. L. Ivors, Y. Balci, M. Peiman, D. C. Erwin, M. D. Coffey, conspeci，c with Fusarium solani f. sp. cucurbitae race 2 from naturally in- A. Rossman, D. Farr, E. Cline, N. J. Gru?nwald, D. G. Luster, J. Schrandt, F. fected human and plant tissue and environmental sources are equally viru- Martin, O. K. Ribeiro, I. Makalowska, and S. Kang. 2008. Phytophthora lent on plants, grow at 37?C and are interfertile. Environ. Microbiol. 9:2189– Database: a forensic database supporting the identi，cation and monitoring 2199. 44. Melcher, G. P., D. A. McGough, A. W. Fothergill, C. Norris, and M. G. of Phytophthora. Plant Dis. 92:966–972. Rinaldi. 1993. Disseminated hyalohyphomycosis caused by a novel human 63. Pennisi, E. 2008. Proposal to ‗wikify‘ GenBank meets stiff resistance. Science 319:1598–1599. pathogen, Fusarium napiforme. J. Clin. Microbiol. 31:1461–1467. 45. Migheli, Q., V. Balmas, H. Harak, S. Sanna, B. Scherm, T. Aoki, and K. 64. Posada, D. 2006. ModelTest Server: a web-based tool for the statistical O’Donnell. 2010. Molecular phylogenetic diversity of dermatologic and other selection of models of nucleotide substitution online. Nucleic Acids Res. 34:W700–W703. human pathogenic fusarial isolates from hospitals in northern and central Italy. J. Clin. Microbiol. 48:1076–1084. 65. Pringle, A., D. M. Baker, J. L. Platt, J. P. Wares, J. P. Latge?, and J. W. Taylor. 2005. Cryptic speciation in the cosmopolitan and clonal human 46. Naiker, S., and B. Odhav. 2004. Mycotic keratitis: pro，le of Fusarium species pathogenic fungus Aspergillus fumigatus. Evolution 59:1886–1899. and their mycotoxins. Mycoses 47:50–56. 66. Pujol, I., J. Guarro, J. Gene?, and J. Sala. 1997. In-vitro antifungal suscep- 47. Nelson, P. E., T. A. Toussoun, and W. F. O. Marasas. 1983. Fusarium species: tibility of clinical and environmental Fusarium spp. strains. J. Antimicrob. an illustrated manual for identi，cation. Pennsylvania State University Press, Chemother. 39:163–167. University Park, PA. 67. Rakemann, J. L., U. Bui, K. LaFe, Y.-C. Chen, R. J. Honeycutt, and B. T. 48. Nucci, M., and E. Anaissie. 2007. Fusarium infections in immunocompro- Cookson. 2005. Multilocus DNA sequence comparisons rapidly identify mised patients. Clin. Microbiol. Rev. 20:695–704. pathogenic molds. J. Clin. Microbiol. 43:3324–3333. 49. O’Donnell, K. 2000. Molecular phylogeny of the Nectria haematococca- 68. Reeb, V., F. Lutzoni, and C. Roux. 2004. Contribution of RPB2 to multilocus Fusarium solani species complex. Mycologia 92:919–938. phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with 50. O’Donnell, K., E. Cigelnik, and H. Nirenberg. 1998. Molecular systematics special emphasis on the lichen-forming Acarosporaceae and evolution of and phylogeography of the Gibberella fujikuroi species complex. Mycologia polyspory. Mol. Phylogenet. Evol. 32:1036–1060. 90:465–493. 69. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a 51. O’Donnell, K., C. Gueidan, S. Sink, P. R. Johnston, P. W. Crous, A. Glenn, R. Riley, N. C. Zitomer, P. Colyer, C. Waalwijk, T. van der Lee, A. Moretti, laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Har- bor, NY. S. Kang, H.-S. Kim, D. M. Geiser, J. H. Juba, R. P. Baayen, M. G. Cromey, S. Bithell, D. A. Sutton, K. Skovgaard, R. Ploetz, H. C. Kistler, M. Elliott, M. 70. Schroers, H.-J., K. O’Donnell, S. C. Lamprecht, P. L. Kammeyer, S. John- Davis, and B. A. J. Sarver. 2009. A two-locus DNA sequence database for son, D. A. Sutton, M. G. Rinaldi, D. M. Geiser, and R. C. Summerbell. 2009. Taxonomy and phylogeny of the Fusarium dimerum species group. Mycolo- typing plant and human pathogens within the Fusarium oxysporum species complex. Fungal Genet. Biol. 46:936–948. gia 101:44–70. 52. O’Donnell, K., H. C. Kistler, E. Cigelnik, and R. C. Ploetz. 1998. Multiple 71. Segal, B. H., T. J. Walsh, J. M. Liu, J. D. Wilson, and K. J. Kwon-Chung. 1998. Invasive infection with Fusarium chlamydosporum in a patient with evolutionary origins of the fungus causing Panama disease of banana: con- cordant evidence from nuclear and mitochondrial gene genealogies. Proc. aplastic anemia. J. Clin. Microbiol. 36:1772–1776. Natl. Acad. Sci. U. S. A. 95:2044–2049. 72. Seifert, K. A. 2009. Progress towards DNA barcoding of fungi. Mol. Ecol. Res. 9(Suppl. 1):83–89. 53. O’Donnell, K., H. C. Kistler, B. K. Tacke, and H. H. Casper. 2000. Gene genealogies reveal global phylogeographic structure and reproductive isola- 73. Spiess, B., W. Seifarth, M. Hummel, O. Frank, A. Fabarius, C. Zheng, H. tion among lineages of Fusarium graminearum, the fungus causing wheat Mo?rz, R. Hehlmann, and D. Buchheidt. 2007. DNA microarray-based de- tection and identi，cation of fungal pathogens in clinical samples from neu- scab. Proc. Natl. Acad. Sci. U. S. A. 97:7905–7910. tropenic patients. J. Clin. Microbiol. 45:3743–3753. 54. O’Donnell, K., B. A. J. Sarver, M. Brandt, D. C. Chang, J. Noble-Wang, B. J. Park, D. A. Sutton, L. Benjamin, M. Lindsley, A. Padhye, D. M. Geiser, and 74. Subrahmanyam, A. 1983. Fusarium laceratum. Mykosen 26:478–480. 75. Summerbell, R. C. 2003. Aspergillus, Fusarium, Sporothrix, Piedraia, and their T. J. Ward. 2007. Phylogenetic diversity and microsphere array-based geno- relatives, p. 237–498. In D. H. Howard (ed.), Pathogenic fungi in humans and typing of human pathogenic fusaria, including isolates from the multistate animals. Marcel Dekker, Inc., New York, NY. contact lens-associated U.S. keratitis outbreaks of 2005 and 2006. J. Clin. 76. Summerbell, R. C., and H.-J. Schroers. 2002. Analysis of phylogenetic rela- Microbiol. 45:2235–2248.