DOC

Quantitation of Major Human Cutaneous Bacterial

By Julie Foster,2014-05-30 12:02
5 views 0
Quantitation of Major Human Cutaneous Bacterial

     JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2010, p. 35753581 Vol. 48, No. 10 0095-1137/10/$12.00 doi:10.1128/JCM.00597-10 Copyright ? 2010, American Society for Microbiology. All Rights Reserved.

    Quantitation of Major Human Cutaneous Bacterial

    and Fungal Populations

    11,2Zhan Gao,* Guillermo I. Perez-Perez,Yu Chen,1,2,3 and Martin J. Blaser1,2,4

    123Departments of Medicine,Microbiology,and Environmental Medicine,New York University Langone Medical Center, New York, New York 10016, and Medical Service, New York Harbor Department of Veteran Affairs Medical Center, 4New York, New York 10010

    Received 21 March 2010/Returned for modication 9 July 2010/Accepted 2 August 2010

Because the human skin microbiota may play roles in the causation or modi;cation of skin diseases, we

    sought to provide initial quantitative analysis from different cutaneous locations. We developed quanti-

    tative PCRs to enumerate the total bacterial and fungal populations, as well as the most common bacterial and fungal genera present in six locales, in eight healthy subjects. We used a set of primers and TaqMan MGB probes based on the bacterial 16S rRNA and fungal internally transcribed spacer region, as well as

    bacterial genus-speci;c probes for Propionibacterium, Corynebacterium, Streptococcus, and Staphylococcus and a fungal genus-speci;c probe for Malassezia. The extent of human DNA contamination of the specimen was determined by quantitating the human housekeeping GAPDH gene. The highest level of 16S rRNA

    copies of bacteria was present in the axilla (4.44 0.18 logcopies/ l [mean standard error of the 10mean]), with normalization based on GAPDH levels, but the other ;ve locations were similar to one

    another (range, 2.48 to 2.89 logcopies/ l). There was strong symmetry between the left and right sides. 10The four bacterial genera accounted for 31% to 59% of total bacteria, with the highest percent composition in the axilla and the lowest in the forearm. Streptococcus was the most common genus present on the forehead and behind the ear. Corynebacterium spp. were predominant in the axilla. Fungal levels were 1 to 2 loglower than for bacteria, with Malassezia spp. accounting for the majority of fungal gene copies. 10These results provide the ;rst quantitation of the site and host speci;cities of major bacterial and fungal populations in human skin and present simple methods for their assessment in studies of disease.

     Human skin harbors a diverse group of microorganisms that allow for an accurate enumeration due to a variety of artifacts (19, 31). However, quantitative real-time PCR (qPCR) may be form complex communities and occupy specic niches and used as an alternative methodology (7, 23). microenvironments (5, 9, 12, 14, 15). While most organisms Based on our prior studies, which characterized the human colonizing the human body may be benecial for health (4, 9, forearm cutaneous microbiota (12, 13, 25, 26), we sought to 18), some relationships with the host can change from com- quantify the human cutaneous microbiota from several body mensal to pathogenic for reasons that are poorly understood locations. The aim of the present study was to develop qPCRs (1). The global composition and presence of specic organisms also is relevant to the biological effects of the skin microbiota. to enumerate total bacterial and fungal populations, as well as The human cutaneous surface includes regions with diverse to determine the most common bacterial and fungal genera in pH, temperature, moisture, and sebum content (14, 17), and different locations on human skin. skin structures such as hair follicles, sebaceous, eccrine, and apocrine glands comprise subhabitats that may be associated MATERIALS AND METHODS with their own unique microbiota (20). Subjects. Specimens from skin were obtained from eight healthy adult Until recently, our knowledge of the bacterial biota in hu- subjects (four males and four females) from 11 body locations, including the man skin has been based mostly on cultivation studies, which forehead, left and right axillae, left and right inner elbows, left and right are insufcient because many organisms cannot be cultured forearms, left and right forelegs, and behind the left and right ears. To (6). The direct PCR amplication and sequencing of bacterial maximize the continuity of our investigations, two of the eight subjects (sub- jects 1 and 3) had been examined in a prior study (12), but new samples were genes encoding the small subunit rRNA (16S rRNA) or vari- obtained for this study. From two of the subjects (subjects 1 and 2), a second able region fragments thereof has been a powerful method to set of samples was collected 1 month later at the same time of day (after- analyze the enormous variation in the human microbiome (8, noon). The subjects were not provided with any specic instructions before 24, 30), showing important differences among a number of the samples were taken. The mean age of the subjects was 38 years (range, 25 cutaneous sites (5, 9, 12, 15). However, analysis of ribosomal to 58); all were in good health and had not received antibiotics for at least 4 months. The study was approved by the NYU Institutional Review Board, and genes (16S rRNA or intergenomic 18S and 23S rRNA) by all subjects provided written informed consent. using clone libraries or high-throughput sequencing may not Specimen processing. Methods for specimen processing have been described elsewhere (12). In brief, a 2- by 2-cm area of the cutaneous surface at each of the 11 locations was sampled by swabbing the skin with a cotton pledget that had * Corresponding author. Mailing address: NY Harbor, Department been soaked in sterile 0.15 M NaCl with 0.1% Tween 20 (Fisher Scientic, Fair of Veterans Affairs Medical Center, 6W RM 6026W, 423 East 23nd Lawn, NJ). DNA was extracted from the swab suspensions in a PCR-free clean St., New York, NY 10010. Phone: (212) 263-4103. Fax: (212) 263-4108. room by using the DNeasy blood and tissue kit (Qiagen, Chatsworth, CA); glass E-mail: Zhan.Gao@nyumc.org. beads (0.5 to 1 mm) were added to the specimens and vortex mixed at maximum Published ahead of print on 11 August 2010. speed for 40 s, followed by DNA extraction, using the manufacturers protocol

    3575

     3576 GAO ET AL. J. CLIN. MICROBIOL.

    TABLE 1. Primers and probes used in this study

     Designation Primer or probe Target Sequence (5 33 ) 8F Primer AGAGTTTGATYMTGGCTCAG Bacteria Eub361R Primer Bacteria CGYCCATTGBGBAADATTCC Eub519F Primer Bacteria CAGCAGCCGCGGTRATA U785R Primer Bacteria GGACTACCVGGGTATCTAAKCC ITS1F Primer Fungi CTYGGTCATTTAGAGGAAGTAA ITS2 Primer Fungi RCTGCGTTCTTCATCGWTG Mal1F Primer Genus Malassezia TCTTTGAACGCACCTTGC Mal1R Primer Genus Malassezia AHAGCAAATGACGTATCATG GAPF Primer Human GAPDH GGGCTCTCCAGAACATCATCC GAPR Primer Human GAPDH GTCCACCACTGACACGTTGG Bacteria_P Probe Bacteria TACGGGAGGCAGCAGT Strep_P Probe Genus Streptococcus AGATGGACCTGCGTTGT Staph_P Probe Genus Staphylococcus CTGTAACTGACGCTGATGTG Prop_P Probe Genus Propionibacterium CTTTCGATACGGGTTGACTT Coryne_P Probe Genus Corynebacterium ACAGYACTCHAGTHATGCCCGT Fungal_P Probe Fungi TCYGTAGGTGAACCTGCRG Mala_P Probe Genus Malassezia ATGCCTGTTTGWGTGC GAP_P Probe Human GAPDH CCTCTACTGGCGCTGCCAAGGCT

for genomic DNA isolation from Gram-positive bacteria, and samples were specicity of the probes. The products studied included eluted in 100 l AE buffer (DNeasy Blood and Tissue kit; Qiagen). To eliminate members of the genus Propionibacterium as well as Strepto- bacterial or DNA contamination, lysozyme (Sigma-Aldrich, St. Louis, MO) was coccus, Staphylococcus, Corynebacterium, Rothia, Gemella, passed through a microcentrifuge lter (molecular mass threshold, 30,000 Da; Micrococcus, and Kocuria species (12). In each case, as ex- Amicon, Bedford, MA) at 18,514 g in a centrifuge (Eppendorf, Germany) for 20 min before adding to the enzymatic lysis buffer. pected, the genus-specic probes recognized the cloned Quantitative PCR. We used sets of primers and TaqMan MGB probes (Table DNA from the species within the same genus but not the 1), based on the bacterial 16S rRNA sequences (12), the fungal internally tran- other common skin genera (data not shown). Assessment of scribed spacer (ITS) sequences (25; http://pmb.berkeley.edu/ bruns/tour sensitivity was performed using 10-fold dilutions of the /primers.html), and the human glyceraldehyde-3-phosphate dehydrogenase gene DNA templates used for the standard curves, corresponding (GAPDH) (28). In addition, we developed genus-specic approaches for Propi- 17onibacterium, Staphylococcus, Streptococcus, Corynebacterium, and Malesezzia, to 3 10to 3 1016S rRNA gene copies per reaction because these have been the most common genera identied in studies using 7mixture. The techniques could detect up to 10competing universal primers (5, 9, 12, 15, 25, 26). PCRs were performed using 3.5 mM organisms. The limit of detection for the genus-specic MgCl2, 0.4 ng/ l bovine serum albumin, 0.2 mM each deoxynucleoside triphos- 12probes ranged from 10to 1016S rRNA gene copies per phate, 10 pmol of each primer, 5 pmol of each probe, 0.625 U Taq DNA polymerase (Qiagen), and 2 l extracted DNA in a nal 25- l volume. PCR reaction mixture. All probes performed well, with correla- conditions were 5 min at 94?C and 45 cycles of 10 s at 94?C, 45 s at 54?C (for tion (R) values of 0.99 for the standard curve and PCR primers 8F/Eub361R) or 56?C (for primers Eub519R/U785R), and 60 s at 72?C. efciencies of 80%. The assays were performed using a Rotor-Gene 6000 system (Corbett Life Contamination by human DNA. To assess the level of con- Science, Sydney, Australia), and a standard curve was constructed by using serial dilutions of cloned PCR products corresponding to each tested species. Each tamination of the skin swab material by human DNA, we sample was tested at least twice, and the results were analyzed using the Rotor- performed qPCR for a human housekeeping gene (GAPDH) Gene 3000 v.6.1.81 software. which is present in all nucleated cells of human origin (10). The Statistical analysis. Statistical analysis was performed with the Paleontological GAPDH qPCR was performed in parallel with the bacterial Statistics Software Package for Education and Data Analysis (http://palaeo -electronica.org/2001_1/past/issue1_01.htm). All qPCR results are presented as qPCRs. In total, for each site, the logmean GAPDH ampli- 10the means of the logvalue the standard errors of the means (SEM). Statis- 10cons per l of sample ranged from 0.07 0.03 (forearm) to tically signicant differences were determined by t tests and one-way analysis of 2.14 0.20 (behind ear) (Fig. 1 and Table 2). In general, the variance (ANOVA) tests for independent samples. ANOVA tests also were standard deviations were low across the 8 to 16 specimens conducted using the SAS 9.2 statistical package for Windows (SAS Institute Inc., sampled per site, indicating that the variation was site specic, Cary, NC) with the PROC GLM procedure. Total variations accounted for by the model and by site, subject, side, and time were based on estimates for the rather than individual specic or technique related. The high- omega-square and semipartial omega-square values. Statistical signicance was est GAPDH values were obtained in specimens from sebaceous dened as a P value of 0.05. The linear regression method was used to assess sites on the head (behind the ear and on the forehead) and the correlation between the proportions of bacteria and fungi from samples were signicantly greater than from the other dry sites (elbow, obtained from the subjects left and right sides. forearm, and foreleg) or moist sites (axilla) (P 0.001).

    Quantitative PCR detection of all bacteria and fungi in RESULTS human skin samples. Real-time PCR analyses were performed Validation of TaqMan MGB probes. To examine the spec- to quantify all bacteria and fungi in the human skin samples

    obtained from 11 body sites (5 bilateral and 1 in the midline). icity of the probes, all probes rst were validated through 37All 82 samples studied from human skin showed 10to 10 the Probe Match algorithm of the Ribosomal Database

    amplicons of bacterial 16S rRNA genes per extraction sample. Project (RDP; http://www.rdp.cme.msu.edu/probematch).

    The enumeration of the total bacteria, as well as four bacterial Subsequently, 16S rRNA gene PCR products from the most

    common skin bacteria genera (12) were used to evaluate the genera in the six cutaneous locales, is shown in Table 2 without

     VOL. 48, 2010 QUANTIFYING CUTANEOUS MICROBIOTA 3577

     indicate substantial quantitative differences in overall bacterial and fungal populations that are site specic. Representation of major genera in human cutaneous sam- ples. Results from our prior studies, based on analysis of ribo- somal genes from clone libraries, provided evidence that four bacterial genera (Corynebacterium, Streptococcus, Staphylococ- cus, and Propionibacterium) and one fungal genus (Malassezia) were the most common genera on the human forearm (12, 25). Our present results show that the four bacterial genera repre- sent 31.3 9.3% (mean standard deviation [SD]) of the bacterial copies in the forearms (Fig. 2A and B), conrming FIG. 1. Representation of bacterial and human DNA in skin swab their dominance among the hundreds of genera identied (5, specimens. For each of six assayed locales, skin swab specimens from 12, 15). Corynebacterium spp. were prominently found on the 8 (forehead) to 16 (all other locales) were obtained, and qPCR was axilla and forehead (Fig. 2B), but there was substantial varia- performed to detect human GAPDH or 16S rRNA using universal bacterial primers. From each site, bacterial amplicons outnumbered tion between individuals (range, 1.0 to 5.08 log/ l in the 10human amplicons by 2 log/ l. 10axilla and 1.0 to 3.86 log/ l on the forehead). More con- 10 sistently low numbers were detected in other body locales. The specimens from the axilla and from the head (behind the ear

    and the forehead) harbored more Streptococcus spp. than did or with normalization to GAPDH levels. Before normaliza- other areas. In total, Streptococcus, Propionibacterium, and tion, the highest bacterial loglevels were found in the axilla 10Staphylococcus populations were variable in the different loca- (4.98 0.13 log/ l), which were substantially greater than 10tions but to a lesser extent than was Corynebacterium (Fig. 2B). the levels observed in the sebaceous sites (4.16 to 4.62 log/ l) 10The proportions of the four genera in the axilla in relation to (P 0.03). Levels at dry sites were even lower ( 3 log/ l) 10the total counts were signicantly higher than those on the (P 0.001). Using normalization, based on the number of forearm, behind the ear, or the foreleg (P 0.01). Malassezia copies of human GAPDH, the highest level of 16S bacterial spp. was calculated to account for 53% to 80% of all fungi in rRNA again was found in the axilla (4.44 0.18 log/ l), and 10the different body locations; the highest numbers (2.74 0.14 the level was 2 loghigher than the levels for the other ve 10log/ l) and highest proportions (80%) were found behind body locations tested. The levels among the other ve locales 10the ear (Table 2 and Fig. 3). were similar to one another (range, 2.48 to 2.89 log/ l). 10Comparison of lateral symmetries of the cutaneous human Before normalization, the range for fungal DNA was narrow

    microbiota. We studied the symmetry of the left and right sides (means, 1.48 to 2.79 log/ l), with the highest levels found 10by comparing the patterns of ve genera in the ve body from the sebaceous sites on the head and with lower levels on

    locales for which bilateral sampling was done. There was pro- the forelegs, forearms, and inner elbows; values for the fore-

    nounced left/right symmetry at all locations (r 0.97 and 0.94 head and behind the ears were virtually identical. After nor-

    malization to GAPDH, the highest level of fungi also was found for bacteria and fungi, respectively) (Fig. 4).

    Comparison of intra- and interpersonal patterns of four in axillae (1.68 0.32 log/ l), with the lowest level found 10major cutaneous bacterial genera. Figure 5 shows the propor- behind the ears (0.64 0.20 log/ l). In total, these results 10

     TABLE 2. Composition of human skin microbiota from six cutaneous locations Mean logcopies/ l SEM 10Data treatment and No. of body location samples All bacteria Corynebacterium Streptococcus Staphylococcus Propionibacterium All fungi Malassezia Human GAPDH Nonnormalized data 8 4.16 0.25 0.77 0.50 3.32 0.22 2.62 0.23 2.65 0.19 2.79 0.22 2.71 0.31 1.62 0.16 Forehead Forearm 16 2.97 0.17 0.06 0.06 2.00 0.13 1.84 0.26 1.85 0.22 1.70 0.14 1.32 0.22 0.07 0.03 Behind ear 16 4.62 0.14 0.60 0.32 3.76 0.17 3.57 0.14 3.56 0.14 2.78 0.14 2.74 0.14 2.14 0.20 Inner elbow 16 2.88 0.22 0.08 0.06 1.92 0.20 1.87 0.31 1.79 0.29 1.59 0.13 1.21 0.22 0.33 0.10 Foreleg 16 3.02 0.14 0.35 0.13 1.97 0.11 2.08 0.23 2.00 0.21 1.48 0.07 1.06 0.14 0.46 0.13 aAxilla 10 4.98 0.13 2.98 0.68 4.16 0.17 4.13 0.14 3.95 0.14 2.22 0.24 2.11 0.31 0.55 0.13

     Normalized with respect to human gapdh 8 2.54 0.21 0.85 0.53 1.70 0.19 1.00 0.20 1.02 0.22 1.17 0.20 1.09 0.27 Forehead Forearm 16 2.89 0.17 0.02 0.05 1.92 0.13 1.77 0.26 1.77 0.22 1.62 0.14 1.25 0.22 Behind ear 16 2.48 0.19 1.54 0.28 1.62 0.19 1.43 0.20 1.42 0.18 0.64 0.20 0.60 0.22 Inner elbow 16 2.56 0.19 0.25 0.08 1.59 0.18 1.54 0.26 1.46 0.23 1.26 0.10 0.88 0.19 Foreleg 16 2.56 0.21 0.11 0.20 1.51 0.19 1.63 0.31 1.54 0.29 1.02 0.13 0.60 0.17 aAxilla 10 4.44 0.18 2.43 0.75 3.62 0.21 3.58 0.20 3.40 0.19 1.68 0.32 1.57 0.39 a Data were not available from three subjects. b Data were normalized by dividing by the number of GAPDH amplicon copies.

     3578 GAO ET AL. J. CLIN. MICROBIOL.

     FIG. 2. Enumeration of major bacterial genera in human cutane- ous samples at six locales. (A) Logamplication of total bacteria and 10 four prominent cutaneous genera: Propionibacterium, Staphylococcus, Streptococcus, and Corynebacterium. The data were not normalized with respect to the human GAPDH gene. (B) Four bacterial genera as a proportion of total bacterial amplicons in six human cutaneous lo- cales. An asterisk indicates that proportions are signicantly (P 0.01) different from other sites. For Corynebacterium, there was substantial interhost variation (from 1% to 45%). tions of four major bacterial genera in eight different subjects. Overall, the patterns from the six locales showed extensive intrahost variation (P 0.001, one-way ANOVA test). The patterns in the same locales but from different individuals also differed substantially. Signicant interindividual differences were observed in the samples from forearms (P 0.004), inner FIG. 4. Lateral symmetry of major microbial populations at ve cu- taneous locales in eight subjects, based on qPCR determination. (A) Ge- nus-level qPCR results for ve cutaneous locales. Values shown are mean log/ l for eight subjects (ve subjects for axilla samples). The genera 10 include Propionibacterium, Staphylococcus, Streptococcus, Corynebacte- rium, and Malassezia. (B) Linear regression analysis of lateral symmetry of bacterial enumeration at ve cutaneous locales, by individual study site. (C) An analysis similar to that in panel B, except universal fungal primers for qPCR were used.

     elbows (P 0.001), axilla (P 0.003), and forelegs (P

     0.002). The composition patterns of the four bacterial genera were similar among different individuals (P 0.05) in the

    samples from the head (behind the ear and the forehead). FIG. 3. Enumeration of fungal species in six cutaneous locales. Analysis of variance also was performed across all of the spec- From the eight tested subjects, a single specimen was obtained from the forehead and bilateral specimens were obtained from forearm, imens to estimate the effects of subject, site, and side on the behind ear, inner elbow, and foreleg; samples from axillae were ob- overall variation (Table 3). For all four major bacterial genera, tained for ve subjects only. qPCR was performed using primers for differences in site accounted for the greatest amount of varia- universal fungal or Malassezia species. Bars indicate mean SD of the tion, which was signicant (P 0.01) in each case. Although values across the subjects. The data were not normalized with respect estimates were lower, the amount of variance attributable to to the human GAPDH gene.

     VOL. 48, 2010 QUANTIFYING CUTANEOUS MICROBIOTA 3579

     (P 0.01). This nding provides evidence that the relationship between subjects and the level of major bacterial populations varies by site. Fluctuation of the four bacterial genera in two subjects. Skin samples were collected 1 month apart from two healthy sub- jects to examine variations in the four major bacterial genera (Fig. 6 and 7). The results of cluster analysis showed that samples from the same subject clustered closely, whereas the two time points were not clustered. Numbers of Streptococcus and Staphylococcus were signicantly different for samples ob- tained 1 month apart, with uctuating proportions of the two genera (P 0.001 and P 0.001, respectively). For Coryne- bacterium and Propionibacterium, time of sampling had little effect on the overall variation, whereas it was the dominant source of variation for Staphylococcus and Streptococcus. The amount of variation in the level of staphylococci and strepto- cocci that is attributable to time (33.2% and 76.6% for staph- ylococci and streptococci, respectively) is greater than the vari-

    ation due to subject, side, or site (all 25% and 1% for

    staphylococci and streptococci, respectively) (Table 3).

     DISCUSSION To investigate the population structure of the human cuta- neous microbiota, a set of primers and TaqMan MGB probes was adapted or designed, validated, and deployed to enumer-

    ate the predominant bacterial and fungal genera in several

     cutaneous locales from healthy human subjects. The results

     show that the qPCR assays are sensitive, rapid, and reproduc-

     ible methods for the quantitation of the major microbial gen- era that populate human skin. For accurate comparison of bacteria and fungi in different samples, the amount of total host DNA can provide a measure to facilitate standardization. Since the GAPDH gene is a con- served human housekeeping gene used to normalize gene ex- pression data (2), a GAPDH qPCR was used to standardize the process of sampling. The relatively high numbers of 16S rRNA bacterial copies in relation to the copies of human GAPDH that we observed demonstrate that skin swabbing captures a population of DNA highly enriched for microbiota. The amount of interindividual variation at each specic locale was low, indicating the relative uniformity of the swabbing proce- dure. Our data suggest that standardization is site specic and differs for sebaceous locales in comparison to dry sites, which have smaller amounts of human DNA. Although further study is needed, site specicity may be presumed for now. FIG. 5. Representation of four bacterial genera at six cutaneous The results from prior studies (5, 9, 12, 13, 15, 25, 26), using sites in eight healthy subjects. Numbers 1 through 8 designate the analysis of ribosomal genes from clone libraries or high- enrolled subjects. (A) Forehead; (B) behind left and right ears; throughput sequencing, provided evidence that four bacterial (C) left and right forearms; (D) left and right forelegs; (E) left and genera, Corynebacterium, Streptococcus, Staphylococcus, and right inner elbows; (F) left and right axillae. For three subjects, no Propionibacterium and one fungal genus, Malassezia, were the axillary specimens were included. The bacterial genera are color coded as for Fig. 4A. most common in the human forearm. Our observation that the total for the four bacterial genera was calculated to represent 31% to 59% of all the bacterial 16S rRNA copies in each of the between-subject differences also was signicant for all genera different locales provides further conrmation of these four

    conserved major populations. That Malassezia spp. repre- except for Corynebacterium. Exploratory analyses also were

    sented 53% to 80% of all the fungal RNA amplicons is con- conducted to assess pair-wise interactions between subjects,

    sistent with our prior studies of the forearm using the clone site, and time. The data indicated signicant interactions be-

    library method (25) and provides further evidence that these tween subjects and site for all four major bacterial populations

     3580 GAO ET AL. J. CLIN. MICROBIOL.

    TABLE 3. Analysis of variance for the four major bacterial populations in the study subjects

     Corynebacterium Propionibacterium Staphylococcus Streptococcus

    Source of variance cP value Estimate (95% CI) P value Estimate (95% CI) P value Estimate (95% CI) P value Estimate (95% cCI) aTotal variance explained45.0 (27.059.0) 69.0 (57.077.0) 68.0 (56.077.0) 76.0 (0.70.8) Variance explained by: 0.05 18.8 (1.630.6) 0.01 21.6 (3.533.7) 0.01 7.5 (0.015.6) 0.01 Subjects 5.5 (0.016.7) Site 41.4 (25.254.8) 0.01 41.4 (23.853.7) 0.01 36.6 (18.949.5) 0.01 58.2 (42.967.6) 0.01 Side 0.5 (0.06.2) 0.57 0.3 (0.05.3) 0.59 0.2 (0.06.0) 0.48 0.0 (0.06.3) 0.37

    Subsample with repeated bmeasurements

     Total variance explained 39.0 (6.063.0) 78.0 (59.087.0) 75.0 (52.085.0) 74.0 (51.085.0) Variance explained by: 0.02 34.4 (7.855.9) 0.01 14.9 (0.039.3) 0.01 0.9 (0.00.13) 0.96 Subjects 11.8 (0.037.5) Site 29.6 (4.553.9) 0.01 25.7 (7.647.8) 0.01 24.8 (0.547.3) 0.01 0.0 (0.014.7) 0.38 Side 2.1 (0.011.0) 0.82 1.4 (0.020.9) 0.11 0.6 (0.013.8) 0.56 0.8 (0.010.0) 0.76 Time 0.9 (0.018.6) 0.45 6.0 (0.028.8) 0.01 33.2 (7.155.1) 0.01 76.6 (59.285.6) 0.01

     a Absolute values (logcopies/ l) for bacterial density used for this analysis. 10 b Ratio of specic bacteria to total bacteria used for this analysis. c CI, condence interval.

    organisms represent the most frequent fungal genus at the axilla harbored the highest density of bacterial copies and the tested locales. highest percentage of the four most common bacterial genera. Many culture-based studies have reported that the compo- Although about 1% of the total bacterial population present in sition of the normal bacterial biota varies according to body all sites of all subjects was Corynebacterium spp., this genus was

    location (11, 21, 22, 29). Our results demonstrated that the most highly represented in the axilla, whereas Streptococci spp.

     were present at higher concentrations than the other three

     bacterial genera on the forehead and behind the ears. Such data extend our knowledge of the site specicity of the distri- bution of bacterial species in human skin and point to a means for further genus-specic explorations. To examine changes in the numbers of the four bacterial genera in the skin samples over time, we collected samples from two of the subjects at intervals 1 month apart as a pilot study. The results showed that the total levels of the four common major genera of the normal human skin biota (3, 11) did not change greatly, but that their proportions did (Fig. 6 and 7). The substantial changes in the proportions of the gen- era Streptococcus and Staphylococcus over time suggest that these might be highly dynamic (Fig. 6 and 7) and should be followed in larger studies. The high correlations observed across sides for each site show that the human skin microbiota has a high level of left/right symmetry, as expected (9, 12, 25); the high correlations also help validate our qPCR ndings. Over time, as indicated by the resampling, the host-specic con- servation persists, but without a strong relationship to the prior sample from the same site. These observations indicate that the major bacterial biota is dynamic (primarily reecting the Strepto- coccus and Staphylococcus populations) over the 1-month period

    sampled and that the changes inuenced both sides similarly.

    In conclusion, we developed quantitative PCR methods to FIG. 6. Clustered display of data from repeat sampling of four investigate the distributions of the four most common bacterial bacterial genera in two subjects. The distribution of four bacterial genera from two healthy subjects (subjects 1 and 2) at two time points genera and one fungal genus in different human cutaneous is represented by a dendrogram based on UPGMA cluster analysis. sites. The data reported here extend previous observations (5, The samples are coded as follows: 1, subject 1; 2, subject 2; a, rst 9, 12, 13, 15, 25) and provide further evidence that the distri- sampling; b, second sampling; FH, Forehead; LX, left axilla; RX, right butions of the major bacterial and fungal genera are both site axilla; LA, left forearm; RA, right forearm; LE, behind left ear; RE, and host specic. As the Human Microbiome Project (16, 27) behind right ear.

VOL. 48, 2010 QUANTIFYING CUTANEOUS MICROBIOTA 3581

4. Cogen, A. L., V. Nizet, and R. L. Gallo. 2008. Skin microbiota: a source of disease or defence? Br. J. Dermatol. 158:442455. 5. Costello, E., and R. Knight. 2009. Bacterial community variation in human body habitats across space and time. Science 326:16941697. 6. Dethlefsen, L., M. McFall-Ngai, and D. A. Relman. 2007. An ecological and evolu- tionary perspective on human-microbe mutualism and disease. Nature449:811818. 7. Dethlefsen, L., S. Huse, M. L. Sogin, and D. A. Relman. 2008. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biol. 6:e280. 8. Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K. E. Nelson, and D. A. Relman. 2005. Diversity of the human intestinal microbial ora. Science 308:16351638. 9. Fierer, N., M. Hamady, C. L. Lauber, and R. Knight. 2008. The inuence of sex, handedness, and washing on the diversity of hand surface bacteria. Proc. Natl. Acad. Sci. U. S. A. 105:1799417999. 10. Foldager, C. B., S. Munir, M. Ulrik-Vinther, K. Søballe, C. Bu?nger, and M. Lind. 2009. Validation of suitable house keeping genes for hypoxia-cultured human chondrocytes. BMC Mol. Biol. 10:94101. 11. Fredricks, D. N. 2001. Microbial ecology of human skin in health and dis- ease. J. Invest. Dermatol. Symp. Proc. 6:167169. 12. Gao, Z., C. H. Tseng, Z. Pei, and M. J. Blaser. 2007. Molecular analysis of human forearm supercial skin bacterial biota. Proc. Natl. Acad. Sci. U. S. A. 104:29272932. 13. Gao, Z., C. H. Tseng, B. Strober, Z. Pei, and M. J. Blaser. 2008. Substantial alterations of the cutaneous bacterial biota in psoriatic lesions. PLoS One 3:e2719. 14. Grice, E. A., H. H. Kong, G. Renaud, A. C. Young, G. G. Bouffard, R. W. Blakesley, T. G. Wolfsberg, M. L. Turner, and J. A. Segre. 2008. A diversity prole of the human skin microbiota. Genome Res. 18:10431050. 15. Grice, E. A., H. H. Kong, S. Conlan, C. B. Deming, J. Davis, A. C. Young, G. G. Bouffard, R. W. Blakesley, P. R. Murray, E. D. Green, M. L. Turner, and J. A. Segre. 2009. Topographical and temporal diversity of the human skin microbiome. Science 324:11901192. 16. Hamady, M., and R. Knight. 2009. Microbial community proling for human mi- crobiome projects: tools, techniques, and challenges. Genome Res. 19:11411152. 17. Holland, K. T., and R. A. Bojar. 2002. Cosmetics: what is their inuence on the skin microora? Am. J. Clin. Dermatol. 3:445449. 18. Hornef, M. W., M. J. Wick, M. Rhen, and S. Normark. 2002. Bacterial strategies for overcoming host innate and adaptive immune responses. Nat. Immunol. 3:10331040. 19. Hurd, P. J., and C. J. Nelson. 2009. Advantages of next-generation sequenc- ing versus the microarray in epigenetic research. Brief. Funct. Genomic Proteomic 8:174183. 20. Kearney, J. N., D. Harnby, G. Gowland, and K. T. Holland. 1984. The follicular distribution and abundance of resident bacteria on human skin. J. Gen. Microbiol. 130:797801. 21. Leyden, J. J., K. J. McGinley, E. Holzle, J. N. Labows, and A. M. Kligman. 1981. The microbiology of the human axilla and its relationship to axillary odour. J. Invest. Dermatol. 77:413416. 22. Leyden, J. J., K. J. McGinley, K. M. Nordstrom, and G. F. Webster. 1987. Skin microora. J. Invest. Dermatol. 88:65s72s. 23. Nasidze, I., J. Li, D. Quinque, K. Tang, and M. Stoneking. 2009. Global FIG. 7. Distribution of four bacterial genera from two subjects at two diversity in the human salivary microbiome. Genome Res. 19:636643. time points. (A) Proportion of the total bacterial amplicons represented 24. Oakley, B. B., T. L. Fiedler, J. M. Marrazzo, and D. N. Fredricks. 2008. The by the four bacterial genera from subject 1 at two time points. The diversity of human vaginal bacterial communities and their association with bacterial genera are color coded as for Fig. 4A. The bars are coded as clinically dened bacterial vaginosis. Appl. Environ. Microbiol. 74:48984909. follows: FH, forehead; LA, left forearm; RA, right forearm; LE, left 25. Paulino, L., C. H. Tseng, B. Strober, and M. J. Blaser. 2006. Molecular behind ear; RE, right behind ear; LX, left axilla; RX, right axilla. The data analysis of fungal microbiota in samples from healthy human skin and pso- were not normalized with respect to the human GAPDH gene. (B) Re- riatic lesions. J. Clin. Microbiol. 44:29332941. 26. Paulino, L., C. H. Tseng, and M. J. Blaser. 2008. Analysis of Malassezia sults for subject 2, with color coding and abbreviations as for panel A. microbiota in healthy supercial human skin and in psoriatic lesions by multiplex real-time PCR. FEMS Yeast Res. 8:460471. 27. Peterson, J., S. Garges, M. Giovanni, P. McInnes, L. Wang, J. A. Schloss, V. progresses, quantitative PCR will enable more-detailed ana- Bonazzi, J. E. McEwen, K. A. Wetterstrand, C. Deal, C. C. Baker, V. Di Francesco, T. K. Howcroft, R. W. Karp, R. D. Lunsford, C. R. Wellington, T. lyses of target taxons of the human cutaneous microbiota, Belachew, M. Wright, C. Giblin, H. David, M. Mills, R. Salomon, C. Mullins, complementing high-throughput sequencing. B. Akolkar, L. Begg, C. Davis, L. Grandison, M. Humble, J. Khalsa, A. R. Little, H. Peavy, C. Pontzer, M. Portnoy, M. H. Sayre, P. Starke-Reed, S. Zakhari, J. Read, B. Watson, and M. Guyer. 2009. The NIH Human Micro- ACKNOWLEDGMENTS biome Project. Genome Res. 19:23172323. This work was supported in part by the Michael Saperstein Medical 28. Regis, S., S. Grossi, S. Lualdi, R. Biancheri, and M. Filocamo. 2005. Diag- nosis of Pelizaeus-Merzbacher disease: detection of proteolipid protein gene Scholars Fund, the Diane Belfer Program in Human Microbial Ecol- copy number by real-time PCR. Neurogenetics 6:7378. ogy, and UH2-AR057506 from the National Institutes of Health. 29. Roth, R. R., and W. D. James. 1988. Microbial ecology of the skin. Annu. Rev. Microbiol. 42:441464. REFERENCES 30. Turnbaugh, P. J., M. Hamady, T. Yatsunenko, B. L. Cantarel, A. Duncan, 1. Avila, M., D. M. Ojcius, and O. Yilmaz. 2009. The oral microbiota: living R. E. Ley, M. L. Sogin, W. J. Jones, B. A. Roe, J. P. Affourtit, M. Egholm, B. with a permanent guest. DNA Cell Biol. 28:405411. Henrissat, A. C. Heath, R. Knight, and J. I. Gordon. 2009. A core gut 2. Barber, R. D., D. W. Harmer, R. A. Coleman, and B. J. Clark. 2005. GAPDH microbiome in obese and lean twins. Nature 457:480484. as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 31. Zhang, H., J. K. DiBaise, A. Zuccolo, D. Kudrna, M. Braidotti, Y. Yeisoo, P. 72 human tissues. Physiol. Genomics 21:389395. Parameswaran, M. D. Crowell, R. Wing, B. E. Rittmann, and R. Krajmalnik- 3. Chiller, K., B. A. Selkin, and G. J. Murakawa. 2001. Skin microora and Brown. 2009. Human gut microbiota in obesity and after gastric bypass. Proc. bacterial infections of the skin. J. Invest. Dermatol. Symp. Proc. 6:170174. Natl. Acad. Sci. U. S. A. 106:23652370.

Report this document

For any questions or suggestions please email
cust-service@docsford.com