JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2010, p. 3738–3741 Vol. 48, No. 10 0095-1137/10/$12.00 doi:10.1128/JCM.00722-10 Copyright ? 2010, American Society for Microbiology. All Rights Reserved.
Is Repeat PCR Needed for Diagnosis of
Clostridium dif;cile Infection?
1Robert F. Luo* and Niaz Banaei1,2,3
12Departments of Pathologyand Medicine (Infectious Diseases),Stanford University School of Medicine, Stanford,
California 94305, and Clinical Microbiology Laboratory, Stanford Hospital and 3Clinics, Palo Alto, California 94304
Received 7 April 2010/Returned for modi，cation 15 May 2010/Accepted 28 July 2010
Patients with diarrhea, de；ned as loose or watery stool, and two or more Clostridium dif;cile tcdB PCR tests
within 14 days of each other were investigated. Repeat PCR for 293 patients with a prior negative result yielded
negative results in 396 (97.5%) of 406 tests. Ten new positives were detected, including one false positive.
Repeat PCR within 7 days appears rarely useful, except for patients with evidence of a new infection.
Currently, the most sensitive method for diagnosis of Clos- included in the study. Testing intervals for each patient were calculated as the number of days between two consecutive tridium dif;cile infection is anaerobic toxigenic stool culture; tests. Patient samples which showed conversions from negative however, in order to provide simpler and faster testing, the to positive results upon repeat PCR testing were tested with a majority of hospitals in the United States rely on enzyme cile) (9, commercial tcdB PCR assay (Cepheid Xpert C. dif;immunoassay (EIA) (3, 8). More recently, real-time PCR as- 13). Discrepancies between the in-house-PCR (discussed be- says targeting the tcdB toxin B gene of C. dif;cile have been low) and commercial-PCR results were resolved with anaero- developed and made commercially available as an alternative to EIA or cell culture cytotoxicity testing of stool (2, 7, 9, 13, bic toxigenic culture (discussed below). A retrospective chart 17, 18, 19). Due to the historically low sensitivity of EIAs, a review was done to identify if patients were hospitalized, had common practice has been to order multiple EIAs to increase been on any antibiotics when the test was ordered, and had any the test’s sensitivity, despite recent studies suggesting that this history of immunosuppression, organ transplantation, malig- may not be helpful and could result in increased false positives nancy, or gastrointestinal manipulation within a week of PCR (5, 11, 12). Similarly, given the higher sensitivity of PCR testing testing. Descriptive statistics and chi-square testing were done and the role of toxin B as the essential virulence factor of C. using Stata analysis software (College Station, TX).
dif;cile, multiple PCR tests may not be necessary (10, 15). The in-house real-time PCR primers were selected using
Although no studies have examined the utility of repeat tcdB tcdB sequences from the NCBI database and included forward
PCR, one study evaluated repeat PCR testing for the tcdC (5 TTGGAAGTACAAAAAGAAGAACTTGA) and reverse
toxin regulatory gene and found that only 1.7% of patients with (5 TTTTAATGTTGTTATTAAAGCATCAGC) primers. For
an initial negative result gave a positive result on subsequent each stool specimen, 0.1 ml was diluted 20-fold in 50% Vertrel testing over 7 days (1). After implementation of tcdB PCR at XF (Miller Stephenson Chemical Company, Danbury, CT) our institution, many physicians continued to request duplicate and subjected to the NucliSens easyMAG platform for DNA or triplicate testing, similar to ordering patterns for the cell extraction (bioMe?rieux, Durham, NC) by the on-board lysis culture cytotoxicity assay or EIA. The purpose of the current protocol according to the instructions of the manufacturer. For study was to examine the clinical utility of repeating tcdB PCR real-time PCR, each 10- l reaction mixture on the Rotor- within 14 days of a negative test result and to provide evidence Gene 6000 (Corbett Life Science, Sydney, Australia) contained on when repeat testing may be warranted. 5 l of 2 FastStart SYBR green master mix (Roche Diag- A retrospective cohort study, approved by the institutional nostics, Indianapolis, IN), 3 l of extracted DNA, and 2 l of review board, was performed at the Stanford Hospital and the 10 M tcdB primer mix. A second reaction mixture, con- Clinics clinical microbiology laboratory on patients with real- taining 5 l of 2 FastStart SYBR green master mix, 3 l of time PCR results for C. dif;cile in stool from July 2009 to extracted DNA, 2 l of 300 copies of an internal control December 2009. Stool samples were routinely accepted for plasmid, and 10 M primer mix speci，c for the plasmid, was PCR in patients who had diarrhea and were over 1 year of age, used to check for inhibition of PCR. The PCR conditions although exceptions were made upon medical director ap- included initial denaturation at 95?C for 5 min and 40 cycles at proval. Diarrhea was de，ned as loose or watery stool which 95?C for 15 s, 60?C for 30 s, and 72?C for 30 s. The ，nal step took the shape of the collection container. All patients with involved a 60?C-to-95?C temperature ramp at a rate of 0.1?C/ two or more tcdB PCR tests within 14 days of each other were second to generate the melting curve. Ampli，ed products in the melting curve plot were analyzed for their intensity and speci，city. A peak with a signal intensity of 0.5 units and a * Corresponding author. Mailing address: Stanford University melting temperature (T) of 76?C 2?C was considered in- m School of Medicine, Department of Pathology, 3375 Hillview Avenue, dicative of positivity for tcdB. If a specimen demonstrated Room 1602, Palo Alto, CA 94304. Phone: (650) 736-8052. Fax: (650) PCR inhibition without positive tcdB ampli，cation, the DNA 725-5671. E-mail: rluo2@stanford.edu. extract was diluted 1:10 and both reactions were repeated. Published ahead of print on 4 August 2010.
3738
VOL. 48, 2010 NOTES 3739
TABLE 1. Performance of tests for diagnosis of years of age. The number of PCR tests per patient ranged from aClostridium dif;cile infection one to six, with a mean of 1.5 tests per patient. One hundred
seventy-one tests (8.8%) were positive, 1,740 (89.3%) were % (no. of positive results/ total no. of results) negative, and 38 (1.9%) were indeterminate due to the pres- Test ence of PCR inhibitors. Of all the tests, 461 (23.7%) were Sensitivity Speci，city repeat tests for patients who already had at least one PCR Anaerobic culture 95.7 (45/47) 100 (70/70) result within the last 14 days. Of these 461 repeat tests, 406 Direct cytotoxicity 83.0 (39/47) 98.6 (69/70) were on 293 patients with a prior negative result, 37 were on 33 Real-time PCR 87.2 (41/47) 98.6 (69/70) patients with a prior positive result, and 18 were on 18 patients a The reference standard was based on anaerobic culture or 2 positive test with a prior indeterminate result. The results for 25 (67.6%) results. tests for patients with a prior positive result converted from positive to negative on repeat testing, the results for 11 (29.7%) remained positive, and the result for 1 (2.7%) was indeterminate. The results for all patients with initial indeter- Specimens with unresolved inhibition were called indetermi-
minate test results were negative on the second PCR except for nate.
one patient, for whom the result remained indeterminate. Prior to its implementation, the performance of PCR was
For the 293 patients with a prior negative result, the highest compared to that of an anaerobic toxigenic culture and a cell
frequency of repeats (22%) occurred within the ，rst 24 h, culture cytotoxicity assay. For the anaerobic culture, stool was
followed by a gradual decline during the following 13 days (Fig. diluted 1:1 in 95% ethanol and incubated at an ambient tem-
perature for 45 min. The sample was then sedimented brie！y, 1). The age range of these patients was from 9 months to 92 one drop of the sediment was added to anaerobic chopped- years. In total, the results for 10 of 406 repeat tests (2.5%) meat carbohydrate broth (CMB) (Anaerobe Systems, Morgan turned positive, while the results for 396 of 406 repeat tests Hill, CA), and a second drop was streaked onto prereduced (97.5%) stayed negative. As shown in Fig. 1, the positives were cycloserine-cefoxitin-fructose agar medium (CCFA-HT for- detected on repeat interval days 2, 5, 6, 7 (n 2), 9, 11, 12 (n
mulation; Anaerobe Systems). The plates were incubated at 2), and 14. Figure 1 also demonstrates that while the majority 37?C for 48 h in the anaerobic chamber. The plates were of repeat tests were ordered during the ，rst 6 days after the
screened for ！at, grayish, and shiny colonies with spreading initial negative result, the majority of positives occurred after edges. Colonies giving positive results with the use of the repeat interval day 6. Only 1.1% (n 3) of 267 repeat tests
RapID ANA system (Remel, Lenexa, KS), a typical horse done less than 7 days after the initial negative result gave manure smell, and ！uorescence under UV light were consid- positive results. New positives were found for both pediatric ered to be C. dif;cile. If CCFA-HT plates did not yield C. (n 2) and adult (n 8) patients, with the ages of these 10 dif;cile colonies, CMB cultures were subcultured on patients ranging from 19 months to 81 years. Only 2 of the 10 CCFA-HT and rescreened as described above. All C. dif;cile patients whose results converted from negative to positive had isolates were inoculated into a new CMB and incubated for 4 more than two tests. The patient whose positive result was days, and the supernatants were tested for cytotoxin. Only detected on day 6 had another negative result on day 6. The isolates showing cytotoxicity were considered positive for pro- patient whose result turned positive on day 9 had another duction of toxin. The cell culture cytotoxicity assay was per- negative test result 13 days earlier. Additional testing with a formed directly on stool samples and also on CMB. Sterilized commercial PCR assay was done on 8 of the 10 samples which ，ltrates were added to MRC-5 cells (Diagnostic Hybrids, Ath- had turned positive, with the remaining samples unavailable ens, OH) with and without C. dif;cile toxin B antitoxin for testing. Seven were con，rmed as true positives, while the (Techlab, Blacksburg, VA). Samples demonstrating cytopathic one from repeat interval day 5 was a false positive, as it was effect only in the absence of antitoxin were considered to be negative by the commercial PCR assay and also by toxigenic positive for C. dif;cile toxin B. culture.
When compared to anaerobic toxigenic culture and cell cul-
ture cytotoxicity assay, PCR was shown to have a sensitivity of
87.2% and speci，city of 98.6% on 47 positive and 70 negative
liquid stool samples (Table 1). The sensitivity was found to be similar to the range of sensitivities for other real-time PCR assays when toxigenic culture was used as the “gold standard.” In those studies, the sensitivities of real-time PCR were 86% and 93% with two in-house assays (14, 16) and between 77% and 94% with commercially available FDA-approved assays (2, 7, 13, 17, l8). Thus, the performance of the real-time PCR assay in the current study is comparable to that of other re- ported assays, and the results obtained from this study can be applied to institutions using either in-house or commercial assays. A total of 1,949 PCR tests were done on stool samples from FIG. 1. Results for repeat PCR tests following a negative result. 1,287 unique patients during the study period. The patient ages The PCR results per day for all patients who underwent repeat testing ranged from 1 month to 108 years, with 84.7% being over 18 1 to 14 days following a prior negative result are shown.
3740 NOTES J. CLIN. MICROBIOL.
Excluding the false-positive case, all nine patients for whom tion of assays with higher sensitivities would only result in
fewer false negatives and consequently make repeat testing the PCR results converted from negative to positive had mul-
even less necessary, providing even more support for our ，nd- tiple risk factors for C. dif;cile infection (3, 4), including cur-
ings. Eliminating unnecessary repeat tests at our institution rent hospitalization (100%), ongoing antibiotic treatment
(66.7%), history of severe underlying disease such as organ would have resulted in a 20% reduction in testing during this
study period. Furthermore, patients suspected to have C. dif- transplantation, immunosuppression, and/or malignancy
;cile infection are routinely placed in private rooms with con- (88.9%), and recent gastrointestinal tube placement (11.1%).
The results for two patients (22.2%) converted from negative tact isolation until the infection can be ruled out, and this to positive less than 7 days after the initial test, although the practice on average costs $100 more per day than the use of a patient with a positive result detected on day 2 did not have a regular hospital bed (6). Without repeat testing, patients with
negative results can be removed from isolation earlier, leading remaining sample for con，rmation. The other seven (77.8%)
patients who converted their PCR result did so 7 or more days to signi，cant savings in testing and isolation costs for the du- after their initial negative result. Six patients had archived stool ration of study period even if we conservatively estimate that
the 396 repeat negative results each resulted in only 1 more day samples, and the results for all six patients were con，rmed as
true positives. Five of these seven patients were tested due to of isolation. As real-time PCR becomes more commonplace new-onset diarrhea after their ，rst test. Another one of these for diagnosis of C. dif;cile infection, clinical ordering practices seven patients was already being treated for a recent outside should adapt to re！ect the increased sensitivity of PCR. To- diagnosis of C. dif;cile infection at the time of the initial neg- gether, these changes will result in improved clinical care and ative test, which may have led to the negative result. lower health care costs.
The ，ndings from this study indicate that repeating C. dif- REFERENCES ;cile tcdB PCR within 14 days of a negative result yields little 1. Aichinger, E., C. D. Schleck, W. S. Harmsen, L. M. Nyre, and R. Patel. 2008. relevant clinical data, other than con，rming the negative result Nonutility of repeat laboratory testing for detection of Clostridium dif;cile by of the initial test, in an overwhelming majority (97.5%) of tests. use of PCR or enzyme immunoassay. J. Clin. Microbiol. 46:3795–3797. 2. Barbut, F., M. Braun, B. Burghoffer, V. Lalande, and C. Eckert. 2009. Rapid Additionally, repeat testing can lead to false positives. With the detection of toxigenic strains of Clostridium dif;cile in diarrheal stools by false positive seen on day 5 disregarded, repeat testing less real-time PCR. J. Clin. Microbiol. 47:1276–1277. 3. Bartlett, J. G., and D. N. Gerding. 2008. Clinical recognition and diagnosis than a week after the initial negative result provided new of Clostridium dif;cile infection. Clin. Infect. Dis. 46:S12–S18. information in only 2 (0.8%) out of 266 tests, or 2 (1.0%) out 4. Bignardi, G. E. 1998. Risk factors for Clostridium dif;cile infection. J. Hosp. of 197 patients. However, the current study does show that Infect. 40:1–15. 5. Cardona, D. M., and K. H. Rand. 2008. Evaluation of repeat Clostridium repeat testing, particularly between interval days 7 and 14, can dif;cile enzyme immunoassay testing. J. Clin. Microbiol. 46:3686–3689. be useful in a small subset of patients with high clinical suspi- 6. Dubberke, E. R., and A. I. Wertheimer. 2009. Review of current literature on cion for infection. Of all the cases whose results converted to the economic burden of Clostridium dif;cile infection. Infect. Control Hosp. Epidemiol. 30:57–66. positive on repeat testing, more than half involved patients 7. Eastwood, K., P. Else, A. Charlett, and M. Wilcox. 2009. Comparison of nine with a recurrence of diarrhea after resolution of their initial commercially available Clostridium dif;cile toxin detection assays, a real-time PCR assay for C. dif;cile tcdB, and a glutamate dehydrogenase detection episode of loose stool, suggesting a different disease process, assay to cytotoxin testing and cytotoxigenic culture methods. J. Clin. Micro- which would explain the change in PCR results. Additionally, biol. 47:3211–3217. all these patients had multiple risk factors for C. dif;cile infec- 8. Gerding, D. N., S. Johnson, L. R. Peterson, M. E. Mulligan, and J. Silva, Jr. 1995. Clostridium dif;cile-associated diarrhea and colitis. Infect. Control tion, including ongoing antibiotic usage, prolonged hospital- Hosp. Epidemiol. 16:459–477. ization, severe underlying illness, immunosuppression, and/or 9. Huang, H., A. Weintraub, H. Fang, and C. E. Nord. 2009. Comparison of a recent gastrointestinal procedures (3, 4). Since a limitation of commercial multiplex real-time PCR to the cell cytotoxicity neutralization assay for diagnosis of Clostridium dif;cile infections. J. Clin. Microbiol. 47: the current study is the lack of con，rmatory toxigenic culture 3729–3731. results and clinical data on all patients with an initial negative 10. Lyras, D., J. R. O’Connor, P. M. Howarth, S. P. Sambol, G. P. Carter, T. Phumoonna, R. Poon, V. Adams, G. Vedantam, S. Johnson, D. N. Gerding, test result, further prospective studies with parallel PCR, tox- and J. I. Rood. 2009. Toxin B is essential for virulence of Clostridium dif;cile. igenic cultures, and close clinical follow-up could help deter- Nature 458:1176–1179. mine which patients may bene，t from repeat PCR testing over 11. Mohan, S. S., B. P. McDermott, S. Parchuri, and B. A. Cunha. 2006. Lack of value of repeat stool testing for Clostridium dif;cile toxin. Am. J. Med. short intervals. 119:356e7-356e8. The usefulness of repeat PCR as a “test of cure” for C. 12. Nemat, H., R. Khan, M. S. Ashraf, M. Matta, S. Ahmed, B. T. Edwards, R. dif;cile infection in patients with initial positive results is also Hussain, M. Lesser, R. Pekmezaris, Y. Dlugacz, and G. Wolf-Klein. 2009. Diagnostic value of repeated enzyme immunoassays in Clostridium dif;cile unclear. Although the results for 67.6% of repeat tests for infection. Am. J. Gastroenterol. 104:2035–2041. patients with prior positive results converted to negative upon 13. Novak-Weekley, S. M., E. M. Marlowe, J. M. Miller, J. Cumpio, J. H. Nomura, P. H. Vance, and A. Weissfeld. 2010. Clostridium dif;cile testing in repeat testing within a 14-day period, the limited sample size the clinical laboratory by use of multiple testing algorithms. J. Clin. Micro- and lack of clinical and laboratory follow-up do not allow us to biol. 48:889–893. determine if these results are from clearance of the infection in 14. Peterson, L. R., R. U. Manson, S. M. Paule, D. M. Hacek, A. Robicsek, R. B. Thomson, Jr., and K. L. Kaul. 2007. Detection of toxigenic Clos- response to treatment or are false negatives. Again, a prospec- tridium dif;cile in stool samples by real-time polymerase chain reaction tive study with testing over short intervals would also help for the diagnosis of C. dif;cile-associated diarrhea. Clin. Infect. Dis. determine when one may expect a negative PCR result after 45:1152–1160. 15. Peterson, L. R., and A. Robicsek. 2009. Does my patient have Clostridium initiation of effective treatment. dif;cile infection? Ann. Intern. Med. 151:176–179. Since the majority of positive conversions occurred after 7 or 16. Sloan, L. M., B. J. Duresko, D. R. Gustafson, and J. E. Rosenblatt. 2008. more days, our ，ndings suggest that repeat PCR testing should Comparison of real-time PCR for detection of the tcdC gene with four toxin immunoassays and culture in diagnosis of Clostridium dif;cile infection. not be done routinely for patients with a prior negative result J. Clin. Microbiol. 46:1996–2001. for at least 7 days. As the assays continue to improve, utiliza- 17. Stamper, P. D., R. Alcabasa, D. Aird, W. Babiker, J. Wehrlin, I. Ikpeama,
VOL. 48, 2010 NOTES 3741
and K. C. Carroll. 2009. Comparison of a commercial real-time PCR assay PCR assay for direct detection of the Clostridium dif;cile toxin B gene in for tcdB detection to a cell culture cytotoxicity assay and toxigenic culture for clinical stool specimens. J. Clin. Microbiol. 47:3846–3850. direct detection of toxin-producing Clostridium dif;cile in clinical samples. 19. van den Berg, R. J., N. Vaessen, H. P. Endtz, T. Schu?lin, E. R. van der Vorm, J. Clin. Microbiol. 47:373–378. and E. J. Kuijper. 2007. Evaluation of real-time PCR and conventional 18. Stamper, P. D., W. Babiker, R. Alcabasa, D. Aird, J. Wehrlin, I. Ikpeama, L. diagnostic methods for the detection of Clostridium dif;cile-associated diar- Gluck, and K. C. Carroll. 2009. Evaluation of a new commercial TaqMan rhoea in a prospective multicentre study. J. Med. Microbiol. 56:36–42.