DOC

Multiplex Amplified Nominal Tandem-Repeat Analysis (MANTRA), a

By Larry Flores,2014-05-28 17:28
10 views 0
Multiplex Amplified Nominal Tandem-Repeat Analysis (MANTRA), a

     JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2010, p. 37583761 Vol. 48, No. 10 0095-1137/10/$12.00 doi:10.1128/JCM.00471-10 Copyright ? 2010, American Society for Microbiology. All Rights Reserved.

Multiplex Amplified Nominal Tandem-Repeat Analysis (MANTRA), a

    Rapid Method for Genotyping Mycobacterium tuberculosis by Use of

    Multiplex PCR and a Microuidic Laboratory Chip

    111Adam J. Merritt,Terillee Keehner,Lyn C. OReilly, 21,3Russell L. McInnes,and Timothy J. J. Inglis*

    1Division of Microbiology & Infectious Diseases, PathWest Laboratory Medicine WA, Nedlands, WA 6009, Australia; 2Agilent Technologies, Forest Hill, Victoria, Australia; and Microbiology & Immunology, School of

    Biomedical, Biomolecular & Chemical Sciences, Faculty of Life & Applied Sciences, University of 3Western Australia, Perth, Australia

    Received 6 April 2010/Returned for modication 9 June 2010/Accepted 3 August 2010

    A variable-number tandem-repeat genotyping method for Mycobacterium tuberculosis was converted to run in

    a multiplex PCR format on a 12-well microuidic laboratory chip. Epidemiologically and genotypically distinct

    isolate clusters of M. tuberculosis were identied. This rapid genotyping method has potential application in smaller clinical laboratories and public health eld investigations.

     In recent years, public health has come to depend on mo- more immediate throughput than either monoplex format lecular methods such as IS6110 typing and spoligotyping to PCR or a DNA sequencer in GeneScan mode. genotype Mycobacterium tuberculosis isolates from clinical M. tuberculosis isolates from Lowenstein-Jensen slopes were samples. These results have been used to identify possible suspended in buffer, sonicated, and heated at 100?C. The 34 clusters of genetically related isolates and thus determine tested isolates included three isolates from an epidemiological whether clustering of infections has taken place. Prompt epi- cluster, four isolates affected by a suspected cross-contamina- demiological application of molecular typing methods has tion event, and 27 unrelated isolates. The identities of the been hampered by the centralization of genotyping in distant isolates and their genotypic and epidemiological relatedness reference centers with high workloads and slow turnaround were not divulged to either the molecular biologist or the time. An important addition to the M. tuberculosis genotyping interpreting pathologist until after examination of the labora- repertoire is based on the detection of variable-number tan- tory chip results was complete. The mycobacterial suspensions dem-repeat (VNTR) sequences (also known as mycobacterial were vortexed, centrifuged at 20,000 RCF for 1 min to pellet interspersed repetitive-unit [MIRU] sequences) (4, 7). An in- gross debris, and diluted to 1:100 to provide template DNA. creasing number of Australian public health laboratories now Multiplexed VNTR amplicons were produced using a Qiagen offer a M. tuberculosis VNTR genotyping service and use an multiplex PCR kit (Qiagen GmbH, Hilden, Germany). Fifteen online VNTR data interpretation web browser (1). Public VNTR primer pairs (Table 1) were incorporated into the mas- health laboratories with both PCR capability and subsequent ter mix at a nal concentration of 0.2 M each. Each reaction gene fragment length analysis can now run this method but at consisted of 10 l of Qiagen 2 master mix, 2 l of Qiagen Q the cost of limited sequencing capacity. An alternative version reagent, 2 l of 10 primer stock, and 6 l of DNA template of the VNTR genotyping method was developed at the Centers for a nal reaction volume of 20 l in a 0.2- l thin-wall PCR for Disease Control and Prevention, using a microuidic Lab- tube. PCR was performed on an Applied Biosystems (ABI, Chip analyzer for endpoint analysis (3). The M. tuberculosis Scoresby, Victoria, Australia) 2720 thermal cycler using the VNTR method has sparked limited interest since then, possi- following protocol: 95?C for 15 min, followed by 35 cycles of bly due to the multiple PCR products that need fragment 94?C for 30 s, 60?C for 90 s, and 72?C for 60 s. A nal extension analysis (9). More recently, VNTR genotyping that combines a step of 72?C for 10 min was performed before the reaction multiplex PCR format with LabChip analysis has been applied mixture was cooled to 4?C. Amplicons were resolved on an to Staphylococcus species (5, 6). In this note, we describe Agilent 2100 bioanalyzer (Agilent Technologies, Forest Hill, MANTRA (multiplex amplied nominal tandem-repeat anal- Victoria, Australia) using a DNA 1000 kit (Agilent), according ysis), a 15-target, fully multiplexed version of VNTR genotyp- to the manufacturers instructions, and analysis was performed ing for M. tuberculosis using the 2100 bioanalyzer in conjunc- using the DNA 1000 series II assay script with default settings. tion with the DNA 1000 laboratory chip in order to achieve At the completion of analysis, all 34 tested samples from three separate analysis les were combined using the comparison feature of the analysis software. The composite gel-like image of the 34 sample set and sizing ladder was saved as a tagged * Corresponding author. Mailing address: Division of Microbiology image le format (TIFF) image (Fig. 1). Every sample was & Infectious Diseases, PathWest Laboratory Medicine WA, Locked compared to every other sample in a pairwise comparison Bag 2009, Nedlands, WA 6009, Australia. Phone: (618) 9346 3461. Fax: approach by overlaying electropherograms, using the upper (618) 9381 7139. E-mail: tim.inglis@health.wa.gov.au. and lower markers as key reference points. Six groups of sam- Published ahead of print on 11 August 2010.

    3758

     VOL. 48, 2010 NOTES 3759 TABLE 1. Primers used in this study Repeat Product size Locus Primer sequence (5 3 ) length (bp) range (bp) a75 270945 ETR-A AAATCGGTCCCATCACCTTCTTAT CGAAGCCTGGGGTGCCCGCGATTT

    aGCGAACACCAGGACAGCATCATG ETR-B 57 178691

    GGCATGCCGGTGATCGAGTGG

    aGTGAGTCGCTGCAGAACCTGCAG ETR-C 58 102624

    GGCGTCTTGACCTCCACGAGTG

    bCATCGAATTGGACTTGCAGCAAT MIRU-2 53 5241,057

    CGACGTCGTAGAGAGCATCGAAT

    bGTCAAACAGGTCACAACGAGAGGAA MIRU-4 77 161854

    CCTCCACAATCAACACACTGGTCAT

    bACCGTCTTATCGGACTGCACTATCAA MIRU-10 53 273750

    CACCTTGGTGATCAGCTACCTCGAT

    bCGGGTCCAGTCCAAGTACCTCAAT MIRU-16 422899 53

    GATCCTCCTGATTGCCCTGACCTA

    bGCCCTTCGAGTTAGTATCGTCGGTT MIRU-20 77 298991

    CAATCACCGTTACATCGACGTCATC

    bCGAATTCTTCGGTGGTCTCGAGT MIRU-23 53 130607

    ACCGTCTGACTCATGGTGTCCAA

    bCGACCAAGATGTGCAGGAATACAT MIRU-24 447915 54

    GGGCGAGTTGAGCTCACAGAA

    bGCGGATAGGTCTACCGTCGAAATC MIRU-26 51 297756

    TCCGGGTCATACAGCATGATCA

    bTCTGCGTGCCAGTAAGAGCCA MIRU-27 53 330807

    CTGATGGTGACTTCGGTGCCTT

    bCGGTCAAGTTCAGCACCTTCTACATC MIRU-39 53 7121,189

    CTCGGTGTTCCTTGAAGGTGGTTT

    bGATTCCAACAAGACGCAGATCAAGA MIRU-40 77 284770

    TCAGGTCTTTCTCTCACGCTCTCG

    a Described by Frothingham and Meeker-OConnell (7). b Described by Cowan et al. (4). The smallest size is 1 copy; the largest size is 10 copies (11 for MIRU-2).

    ples with highly similar patterns were obtained by this method. isolates from a group of international students residing in These were downselected from the full 34 sample set, and a housing on the same street. Isolate 9 (Fig. 2, lane 9) was second composite gel image was generated (Fig. 2). The rst obtained from a patient with no obvious epidemiological group (group 1) shown in lanes 4, 5, 6, and 9 of Fig. 2 contains connection other than a similar geographic origin. Groups 2