JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2010, p. 3758–3761 Vol. 48, No. 10 0095-1137/10/$12.00 doi:10.1128/JCM.00471-10 Copyright ? 2010, American Society for Microbiology. All Rights Reserved.
Multiplex Amplified Nominal Tandem-Repeat Analysis (MANTRA), a
Rapid Method for Genotyping Mycobacterium tuberculosis by Use of
Multiplex PCR and a Micro！uidic Laboratory Chip
111Adam J. Merritt,Terillee Keehner,Lyn C. O’Reilly, 21,3Russell L. McInnes,and Timothy J. J. Inglis*
1Division of Microbiology & Infectious Diseases, PathWest Laboratory Medicine WA, Nedlands, WA 6009, Australia; 2Agilent Technologies, Forest Hill, Victoria, Australia; and Microbiology & Immunology, School of
Biomedical, Biomolecular & Chemical Sciences, Faculty of Life & Applied Sciences, University of 3Western Australia, Perth, Australia
Received 6 April 2010/Returned for modi，cation 9 June 2010/Accepted 3 August 2010
A variable-number tandem-repeat genotyping method for Mycobacterium tuberculosis was converted to run in
a multiplex PCR format on a 12-well micro？uidic laboratory chip. Epidemiologically and genotypically distinct
isolate clusters of M. tuberculosis were identi；ed. This rapid genotyping method has potential application in smaller clinical laboratories and public health ；eld investigations.
In recent years, public health has come to depend on mo- more immediate throughput than either monoplex format lecular methods such as IS6110 typing and spoligotyping to PCR or a DNA sequencer in GeneScan mode. genotype Mycobacterium tuberculosis isolates from clinical M. tuberculosis isolates from Lowenstein-Jensen slopes were samples. These results have been used to identify possible suspended in buffer, sonicated, and heated at 100?C. The 34 clusters of genetically related isolates and thus determine tested isolates included three isolates from an epidemiological whether clustering of infections has taken place. Prompt epi- cluster, four isolates affected by a suspected cross-contamina- demiological application of molecular typing methods has tion event, and 27 unrelated isolates. The identities of the been hampered by the centralization of genotyping in distant isolates and their genotypic and epidemiological relatedness reference centers with high workloads and slow turnaround were not divulged to either the molecular biologist or the time. An important addition to the M. tuberculosis genotyping interpreting pathologist until after examination of the labora- repertoire is based on the detection of variable-number tan- tory chip results was complete. The mycobacterial suspensions dem-repeat (VNTR) sequences (also known as mycobacterial were vortexed, centrifuged at 20,000 RCF for 1 min to pellet interspersed repetitive-unit [MIRU] sequences) (4, 7). An in- gross debris, and diluted to 1:100 to provide template DNA. creasing number of Australian public health laboratories now Multiplexed VNTR amplicons were produced using a Qiagen offer a M. tuberculosis VNTR genotyping service and use an multiplex PCR kit (Qiagen GmbH, Hilden, Germany). Fifteen online VNTR data interpretation web browser (1). Public VNTR primer pairs (Table 1) were incorporated into the mas- health laboratories with both PCR capability and subsequent ter mix at a ，nal concentration of 0.2 M each. Each reaction gene fragment length analysis can now run this method but at consisted of 10 l of Qiagen 2 master mix, 2 l of Qiagen Q the cost of limited sequencing capacity. An alternative version reagent, 2 l of 10 primer stock, and 6 l of DNA template of the VNTR genotyping method was developed at the Centers for a ，nal reaction volume of 20 l in a 0.2- l thin-wall PCR for Disease Control and Prevention, using a micro！uidic Lab- tube. PCR was performed on an Applied Biosystems (ABI, Chip analyzer for endpoint analysis (3). The M. tuberculosis Scoresby, Victoria, Australia) 2720 thermal cycler using the VNTR method has sparked limited interest since then, possi- following protocol: 95?C for 15 min, followed by 35 cycles of bly due to the multiple PCR products that need fragment 94?C for 30 s, 60?C for 90 s, and 72?C for 60 s. A ，nal extension analysis (9). More recently, VNTR genotyping that combines a step of 72?C for 10 min was performed before the reaction multiplex PCR format with LabChip analysis has been applied mixture was cooled to 4?C. Amplicons were resolved on an to Staphylococcus species (5, 6). In this note, we describe Agilent 2100 bioanalyzer (Agilent Technologies, Forest Hill, MANTRA (multiplex ampli，ed nominal tandem-repeat anal- Victoria, Australia) using a DNA 1000 kit (Agilent), according ysis), a 15-target, fully multiplexed version of VNTR genotyp- to the manufacturer’s instructions, and analysis was performed ing for M. tuberculosis using the 2100 bioanalyzer in conjunc- using the DNA 1000 series II assay script with default settings. tion with the DNA 1000 laboratory chip in order to achieve At the completion of analysis, all 34 tested samples from three separate analysis ，les were combined using the comparison feature of the analysis software. The composite gel-like image of the 34 sample set and sizing ladder was saved as a tagged * Corresponding author. Mailing address: Division of Microbiology image ，le format (TIFF) image (Fig. 1). Every sample was & Infectious Diseases, PathWest Laboratory Medicine WA, Locked compared to every other sample in a pairwise comparison Bag 2009, Nedlands, WA 6009, Australia. Phone: (618) 9346 3461. Fax: approach by overlaying electropherograms, using the upper (618) 9381 7139. E-mail: tim.inglis@health.wa.gov.au. and lower markers as key reference points. Six groups of sam- Published ahead of print on 11 August 2010.
3758
VOL. 48, 2010 NOTES 3759 TABLE 1. Primers used in this study Repeat Product size Locus Primer sequence (5 –3 ) length (bp) range (bp) a75 270–945 ETR-A AAATCGGTCCCATCACCTTCTTAT CGAAGCCTGGGGTGCCCGCGATTT
aGCGAACACCAGGACAGCATCATG ETR-B 57 178–691
GGCATGCCGGTGATCGAGTGG
aGTGAGTCGCTGCAGAACCTGCAG ETR-C 58 102–624
GGCGTCTTGACCTCCACGAGTG
bCATCGAATTGGACTTGCAGCAAT MIRU-2 53 524–1,057
CGACGTCGTAGAGAGCATCGAAT
bGTCAAACAGGTCACAACGAGAGGAA MIRU-4 77 161–854
CCTCCACAATCAACACACTGGTCAT
bACCGTCTTATCGGACTGCACTATCAA MIRU-10 53 273–750
CACCTTGGTGATCAGCTACCTCGAT
bCGGGTCCAGTCCAAGTACCTCAAT MIRU-16 422–899 53
GATCCTCCTGATTGCCCTGACCTA
bGCCCTTCGAGTTAGTATCGTCGGTT MIRU-20 77 298–991
CAATCACCGTTACATCGACGTCATC
bCGAATTCTTCGGTGGTCTCGAGT MIRU-23 53 130–607
ACCGTCTGACTCATGGTGTCCAA
bCGACCAAGATGTGCAGGAATACAT MIRU-24 447–915 54
GGGCGAGTTGAGCTCACAGAA
bGCGGATAGGTCTACCGTCGAAATC MIRU-26 51 297–756
TCCGGGTCATACAGCATGATCA
bTCTGCGTGCCAGTAAGAGCCA MIRU-27 53 330–807
CTGATGGTGACTTCGGTGCCTT
bCGGTCAAGTTCAGCACCTTCTACATC MIRU-39 53 712–1,189
CTCGGTGTTCCTTGAAGGTGGTTT
bGATTCCAACAAGACGCAGATCAAGA MIRU-40 77 284–770
TCAGGTCTTTCTCTCACGCTCTCG
a Described by Frothingham and Meeker-O’Connell (7). b Described by Cowan et al. (4). The smallest size is 1 copy; the largest size is 10 copies (11 for MIRU-2).
ples with highly similar patterns were obtained by this method. isolates from a group of international students residing in These were downselected from the full 34 sample set, and a housing on the same street. Isolate 9 (Fig. 2, lane 9) was second composite gel image was generated (Fig. 2). The ，rst obtained from a patient with no obvious epidemiological group (group 1) shown in lanes 4, 5, 6, and 9 of Fig. 2 contains connection other than a similar geographic origin. Groups 2
FIG. 1. Gel-like image of MANTRA M. tuberculosis genotyping results, showing 34 analyzed samples and a DNA fragment size ladder. Upper and lower size markers are present in ladders and all M. tuberculosis isolate lanes. The vertical scale represents migration time.
3760 NOTES J. CLIN. MICROBIOL.
FIG. 2. Gel-like image of MANTRA M. tuberculosis genotyping results, showing a DNA fragment size ladder and 16 downselected samples. Isolate designation is shown at the top of each lane; group assignment is shown at the bottom. Upper and lower size markers are present in ladders and all M. tuberculosis isolate lanes. The vertical scale represents migration time.
to 5 contained pairs of isolates that had very similar patterns importance of restricting application of VNTR methods to but no known epidemiological link. Group 6 contained four isolates from a single epidemiological lineage (2). Although a samples that were implicated in a laboratory contamination number of less closely related isolates were recognized, no event, resulting in a single isolate being introduced to mul- attempt was made to determine a measure of isolate similarity tiple samples. A number of other isolates were less closely since this would be beyond the intended scope of the method. related, differing by 2 or more electropherogram peaks. All The other important caveat is the need to seek further con，r-
results were stored as Agilent run ，les (denoted as .XAD mation of apparent genotypic clustering by a distinct second ，les) and subsequent comparison ，les and then downloaded method such as spoligotyping or IS6110 typing. Spoligotyping
as TIFF ，les for onward transmission. is the preferred method for combination with VNTR-MIRU Tuberculosis is one of the most common fatal infections genotype results in the previously noted web browser (1). This worldwide. Its ease of transmission, ability to remain dormant combination of methods is generally restricted to large refer- in apparently healthy people, and the dif，culty of effective ence centers and may take weeks or months to return de，nitive
treatment present a unique challenge to public health author- results. The methods we describe here allow a preliminary ities. The impact of M. tuberculosis genotyping on public health assessment of M. tuberculosis phylogeny during the early stages has been limited by slow turnaround time, high running cost, of a public health investigation when results are of most use in and possibly the centralization of genotyping services. The guiding disease control. The equipment required for M. tuber-
method described here is fast, is relatively inexpensive, and can culosis MANTRA is the same as that used previously for ，eld-
be operated in small clinical microbiology laboratories using work overseas (8), raising the possibility of inserting genotyp- equipment employed for a range of other molecular microbi- ing capability closer to the main burden of disease. This ology procedures. It successfully distinguished an epidemiolog- method may therefore be suitable in the future as close sup- ical cluster and a possible additional isolate of similar geo- port for tuberculosis control programs. In addition, the alter- graphic origin previously unknown to the molecular biologist native laboratory chip result format provided in the bioana- and interpreting pathologist. Additionally, a second cluster of lyzer software can be used to compare samples analyzed on isolates was implicated in a laboratory contamination event. In different chips or on different analyzers located in geographi- MANTRA, multiple products are produced without any inten- cally separated laboratories.
tion of allocating speci，c alleles in subsequent analysis. No REFERENCES ！uid handling was required to combine PCR products because 1. Allix-Be?guec, C., D. Harmsen, T. Weniger, P. Supply, and S. Niemann. 2008. the ampli，cation step was a true multiplex PCR. As with all Evaluation and strategy for use of MIRU-VNTR plus, a multifunctional database for online analysis of genotyping data and phylogenetic identi，ca- clinical molecular biology methods, there are caveats. The tion of Mycobacterium tuberculosis complex isolates. J. Clin. Microbiol. 46: MANTRA method is intended for comparative use, as indi- 2692–2699. cated by the “N” (for “nominal”), a reminder that the tech- 2. Comas, I., S. Homolka, S. Niemann, and S. Gagneux. 2009. Genotyping of genetically monomorphic bacteria: DNA sequencing in Mycobacterium tuber- nique does not aim to be a stand-alone genotyping method. culosis highlights the limitations of current methodologies. PLoS One 4:e7815. This may be unimportant when no more than a comparative 3. Cooksey, R. C., J. Limor, G. P. Morlock, and J. T. Crawford. 2003. Identifying analysis of current isolates is required but could cause dif，culty Mycobacterium species and strain typing using a micro！uidic labchip instru- ment. Biotechniques 35:786–794. when attribution of a speci，c allele number is needed for 4. Cowan, L. S., L. Mosher, L. Diem, J. P. Massey, and J. T. Crawford. 2002. comparison with a national or international isolate collection. Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repet- A recent comparison of 15-target and 24-target VNTR typing itive units. J. Clin. Microbiol. 40:1592–1602. of M. tuberculosis highlighted the inability of VNTR-based 5. Francois, P., A. Huyghe, Y. Charbonnier, M. Bento, S. Herzig, I. Topolski, B. typing methods to detect all strain lineages and emphasized the Fleury, D. Lew, P. Vaudaux, S. Harbarth, W. van Leeuwen, A. van Belkum,
VOL. 48, 2010 NOTES 3761
D. S. Blanc, D. Pittet, and J. Schrenzel. 2005. Use of an automated multiple- 7. Frothingham, R., and W. A. Meeker-O’Connell. 1998. Genetic diversity in the locus, variable-number tandem repeat-based method for rapid and high- Mycobacterium tuberculosis complex based on variable numbers of tandem throughput genotyping of Staphylococcus aureus isolates. J. Clin. Microbiol. DNA repeats. Microbiology 144:1189–1196. 43:3346–3355. 8. Inglis, T. J., A. Merritt, J. Montgomery, I. Jayasinghe, V. Thevanesam, and R. 6. Francois, P., A. Hochmann, A. Huyghe, E. J. Bonetti, G. Renzi, S. Harbarth, McInnes. 2008. Deployable laboratory response to emergence of melioidosis C. Klingenberg, D. Pittet, and J. Schrenzel. 2008. Rapid and high-throughput in central Sri Lanka. J. Clin. Microbiol. 46:3479–3481. genotyping of Staphylococcus epidermidis isolates by automated multilocus 9. Sajduda, A., J. Dziadek, R. Kotłowski, and F. Portaels. 2006. Evaluation of variable-number of tandem repeats: a tool for real-time epidemiology. J. multiple genetic markers for typing drug-resistant Mycobacterium tuberculosis Microbiol. Methods 72:296–305. strains from Poland. Diagn. Microbiol. Infect. Dis. 55:59–64.