DOC

[doc] Synergy of DNA methylation and histone deacetylase inhibitors in the re-expression of RASSFIA and P16 genes silenced in QBC cells

By Steven Webb,2014-09-08 12:59
8 views 0
[doc] Synergy of DNA methylation and histone deacetylase inhibitors in the re-expression of RASSFIA and P16 genes silenced in QBC cells

    Synergy of DNA methylation and histone deacetylase inhibitors in the re-expression of RASSFIA and P16 genes silenced in QBC

    cells

SynergyofDNAmethylationandhistonedeacetylase

    ;inhibitorsinthere--expressionofRASSFIAandP16

    ;genessilencedinQBCcells

    ;HongLi,ShaoqinChen,YiShu,YongjunChen,YingSu,XinWang,ShengquanZou

    ;DepartmentofGeneralSurgery,TongjiHospital,

    ;University,Wuhan430030,China

    ;TongjiMedicalCollege.HuazhongScience&Technology ;Received:25August2008/Revised:27September2008/Accepted:20October2008

    ;AbstractObjective:ToinvestigatetheeffectsofDNAmethylationandhistonedeacetylaseinhibitorsinthereexpression

    ;OfP16andRASSIF1AofQBC939.Methods:TheQBC939cellswerelreatedwithhydralazineandvalproateeitheraloneor

    ;combined.andIhecontroIgroupwasaddedwithRPIM.1640culturemedium.Afer48h,lheexpressionofP16andRASSF1A

    ;geneswereevaluatedbyreversetranscription-PCR.Westernblot.andlhemethylationstatusoflhetwogenesweredetected

    ;withMSPfmethylationspecificPCR).

    esults:HydralazineandvalproatecouldinducedemethylationofIhepromoterregion

    ;0flhetwogenes.andcouldmakelhemre.active.TheexpressionsofP16andRASSF1Aofcellslreatedwithbothdrugswere

    ;higherlhanlhaloflhecellslreatedwitheitherhydralazineorvalproatefP<0.01).TherewasnoRASSF1Agene,andfewP16

    ;geneexpressinginlhecontrolgroup.ThedemethylationeffeclcouldbefoundinIhegroupslreatedwithhydralazineorboth

    ;drugs.whereasnodemethylationeffeclhappenedinlhevalproategroup.ConclusionThetwodrugscouldsynergistically

    ;re.expressP16andRASSF1AgenessilencedinQBC939.andtheyexertedagrealanti-turnouteffectonQBCcells.

    ;KeywordsDNAmelhyflransferaseinhibitor;histonedeacetylaseinhibitor;DNAhypermelhylaci0n:genereexpression

    ;Manystudiesdemonstratedthatthepromoterofmost

    ;oftumorsuppressorgenesinmanykindsofhumancan

    ;cersarehypermethylated,whereastheyareunmethylat

    ;edonnormaltissue_l__Itisalsoreportedthatthemecha

    ;nismforthehyperrnethylationassociatedgenesilencing

;isthattheDNAstructurechangestoacompact,con

    ;densedchromatinconfiguration,whichresultsinastable ;inhibitionofmessengerRNAandproteinproduction ;Recently,itisprovedthatDNAhypermethylationand ;histonedeacetylationarecriticalfordeterminingaclosed ;chromatinstructureresponsiblefororrelatedwithaber

    ;rantgenetranscriptioninmalignancies.Henceusing ;inhibitorsofDNAmethylationandhistonedeacetylases ;fHDAC)incombinationtoincreaseschromatinrelax

    ;ationtoreactivesilencedsuppressorgenesareatpresent ;undergoingtestingforcancertherapy.

    ;RASSF1Aisatumorsuppressorgenewhichiscloned ;from3p21.3ofchromosome[4’it’Sfunctioninvolvein

    ;apoptoticsignaling,microtubulestabilization,andcell ;cycleprogression.Inourpreviousstudies[‘.theexpres—

    ;sionlossrateofRASSF1Ainextrahepaticbiliarytract ;carcinomatissueswas68.75%whichwasmuchhigher ;thanthatinadjacentnoncanceroustissues.P16aswe

    ;Correspondenceto:HongLi.Email:rbvs@163.com ;allknowisacriticalgeneincellcircleregulation.The ;p16inhibitscellcycleprogressionthroughG1toSphase ;bymaintainingtheRbproteinintheunphosphorylated

    ;state,whichcanledcellsescapefromsenescenceand ;cancerformation.Inaddition.P16andRASSF1Agene

    9].Fromthe ;couldbedetectedsilencedinmanytumors[7

    ;above,wecanconcludethatthesetwogenesactimpor

    ;tantroleinpreventmgcellcanceratlon,reexpressingthe

    ;twogenescouldbenefitalotintumourtreating. ;HopkinsMedicalInstitutions’srecentresearchdem—

    ;onstratethatthefrequencyofRASSF1ARenemethyla

    ;tionincholangiocarcinomawas65%.thehighestinthe ;12candidatetumorsuppressorgenes,andthefrequency ;ofP16genewas50%,thesecondhighestinthe12can

    ;didatetumorsuppressorgenes[10].Fromtheresearchwe ;knowthathypermethylationisthemainreasonforP16 ;andRASSF1Asilencinginchlangiocarcinoma.Thus,we ;wantedtodetectthemethylationstatusofpromoterre

    ;gionofthetwogenesanddeterminetheinfluenceof ;hydralazine(aDNAmethyltransferaseinhibitor)and ;valproate(ahistonedeacetylaseinhibitor)m,121ontheex

    ;pressionoftheminHumanBiliaryTractCarcinomaCells ;(QBC939cells1.

    ;628

    ;Materialsandmethods

;Materials

    ;HumanbiliarytractcarcinomacelllineQBC939was

    ;agenerousgiftfromDr.ShuguangWang(TheThird ;MilitaryMedicalUniversity,China).Hydralazineand ;valproatewaspurchasedfromSigmaCo.(USA).Mono

    ;clonalantibodytoP16andRASSF1AfmouseIgG11was ;producedbyBDCo.(USA)andpurchasedfromGoogle ;BioTechCo.Ltd.fChina).HRPlabeledgoatantimouse

    ;IgG(H+L)wasproducedbyPierceCo.andpurchased ;fromZhongshanBioTechCo.fChina).A11theprimers ;inthisstudyweresynthesizedbytheTAKARACo.Ltd. ;(Japan).

    ;Methods

    ;Ceiicultlife

    ;ThehumanbiliarytractcarcinomacelllineQBC939

    ;cellswereculturedinRPMI1640supplementedwith ;10%heatinactivatedfetalbovineserumandincubated ;inahumidifiedatmospherewith5%CO7at37.C. ;Chemicalterventionwithhvdralazineandvalproate ;Thehydralazineandvalproateweredissolvedin ;RPMI1640medium,andadjustthefinalconcentrationof ;hvdralazineandvalproatetobeboth10gmol/mL.The

    ;OBC939cellsweredividedinto4groups.Onegroupwas ;addedinHydralazineandvalproate,adjustingthetwo ;drugsfinalconcentrationtobe10pmol/mL.ODegroup ;treatedwiththesamevolumeofRPMI1640medium ;wastakenascontrolgroup.Theothertwogroupswere ;separatelyaddedinhydralazineorvalproate,thenmake ;theirfinalconcentrationtobe10~mol/mL.Thecellsin ;experimentalgroupsandincontrolgroupwerecollected ;forfurtheranalysis48hlater.

    ;ExtractionofgenomicDNAandbisulfitemodification ;TotalgenomicDNAwasextractedfromtheexperi

    ;mentalgroupandcontrolgroupaccordingtoinstruction ;ofDNAextractionkit.Thebisulfitemodificationofge

    ;nomicDNAwascarriedoutaccordingtothemethodin ;Ref13l131.

    ;Meylaaonspecificpolymerasechainreaction ;ThemethylationstatusinthepromoterregionofP16 ;andRASSF1Agenewasdetectedbymethylationspecific

    ;polymerasechainreactionfMSPCR).Themethylated

    ;primerofP16genewas:sense5’TTATTAGAGGGT

    ;GGGGCGGATCGC3’,antisense5’GACCCCGAA

    ;CCGCGACCGTAA3’:theun—methylatedprimerswas:

;sense5’TTATTAGAGGGTGGGGTGGATTGT3’,

    ;antisense5’-CAACCCCAAACCACAACCATAA3’;

    ;annealtemperaturewasboth65?.thelengthofmeth

    ;ylatedproductwas150bp,thelengthofunmethylated

    ;productwas151bp;themethylatedprimeraturewasboth60.C, ;thelengthofproductswereboth169bp.Methylation

    ;specificpolymerasechainreactionwascarriedoutac

    ;cordingtoRef13113_.

    PCRanalvsis ;RT

    ;TotalRNAwasextractedfromtheexperimentalgroup ;cellsandcontrolgroupcellsusingTrizolreagent.The ;firststrandofcDNAtakenasPCRtemplatewassyn

    ;thesizedbyreversetranscriptionfRT1accordingtothe ;instructionofRTkit.ThesequencesofprimersforP16 ;genewere:sense5’-AGCCTTCGGCTGACTGGCTGG

    ;3’,antisense5’CTGCCCATCATCATGACCTGG3’,the

    ;lengthofproductwas407bp;theprimersforRASSF1A ;were:sense5’-GGCGTCGTGCGCAAAGGCC3’,anti—

    ;sense5’GAACCTTGATGAAGCCTGTG3’,the1engthof

    ;productwas280bp.ThesequencesofprimersforDactin

    ;genewere:sense5’-CATCACTATCGGCAATGAGC3’,

    ;antisense5’GACAGCACTGTGTTGGCAA3’.B—actin

    ;wasusedasaninternalcontro1.ThePCRreactionwas ;performedaccordingtotheparameters:P1694?for5

    ;min,32cyclesat94?for45s,58?for45s,74?for45

    ;s.andthenitwasextendedat74?for5min;RASSF1A

    ;95?for2min,32cyclesat95?for1min,59?for1

    ;min,72?for2min;72?for5mintoextend.ThePCR

    ;productswereseparatedona1.5%agarosegelcontain

    ;ing0.5%ethidiumbromideandwereobservedunderUV ;illumination.Theopticaldensitywasautomaticallymea

    ;suredandintegratedbygeldataacquisitionAlphaImager ;HPsoftware(AlphaInnotechCorp.,SanLeandro,CA, ;USA1.AratioofP16orRASSF1Aandf3-actinrepresented ;therelativelevelofP16orRASSF1Aexpression. ;Westernblotanalysis

    ;Thetotalproteinoftheexperimentalgroupcellsand ;controlgroupceilswereextractedrespectivelyandsepa

    ;ratedon8%SDSpolyacrylamidegelfollowedbyelectrob

    ;lottedtoPVDFmembranes.Membraneswereblockedin ;Trisbufferedsalinewith5%nonfatdrymilk,andthen

    ;incubatedwith1:1000dilutionofthemousemonocle

    ;nalantibodyagainsthumanP16andRASSF1Aovernight ;at4?.AfterseveralwashesinTBST,goatantimouse

    ;secondaryantibodieslabeledwithhorseradishperoxidase ;wereusedtobindtheprimaryantibodiesatroomtem

    ;peraturefor2-3h,anddetectionwasperformedbyche

    ;miluminescencesystemasdirectedbythemanufacturer. ;Results

    ;Detectionofmethylationstatusinthe

    ;promoterregionofP16andRASSFIA

    ;TheresultofMSPCRforRASSF1Ashowedthata169

    ;bpDNAbandwasamplified

    ;andnocorrespondingDNA

    ;byusingmethylatedprimers

    ;bandwasdetectedbyusing

    ;ChineseGermanTClinOncol,November2008,Vo1.7,No.11 ;unmethylatedprimersincontrolgroupandvalproate ;group;inhydralazinegroup,DNAbandswerebotham

    ;plifiedbyusingmethylatedprimersandunmethylated

    ;primers;however,169bpDNAbandwasamplifiedby ;usingunmethylatedprimersandnocorrespondingDNA ;bandwasobservedinbothdrugsgroup.TheresultofMS

    ;PCRforP16wasthatDNAbandsamplifiedwithmeth

    ;ylatedprimersandunmethylatedprimerscouldbede

    ;tectedincontrolgroup,valproategroupandhydralazme

    ;group;butinbothdrugsgrouponlyDNAbandsamplified ;withmethylatedprimerscouldbeshowed(Fig.1). ;Detection0fRASSF1AmRNAexpression

    ;alteration

    ;AsshownintheFig.2thatthefragmentofP16,RASS

    ;F1Aand6actin(interna1contro1)cDNAwere407bp, ;280bpand156bp,respectively.Itwasshownthatthere ;wasnofragmentofRASSF1Aincontrolgroupandval

    ;proategroup.howevertheRASSF1AmRNAwasdetect

    ;edinhydralazinegroupandbothdrugsgroup,andthe ;measurementshowedthatthelevelofRASSF1Aexpres

    ;sioninducedbybothdrugswasmuchhigherthanthatof ;theHvdralazinegroup(P<0.01).Therewereidentical ;minimalP16mRNAwasdetectedincontrolgroupand ;valproategroup,moderateP16mRNAwasdetectedin ;hydralazinegroup,themRNAofP16inbothdrugsgroup ;wasmaxima1ofthe4groups(P<0.01;Fig.2). ;DetectionofRASSFIAproteinexpression

    ;alteration

    ;IncorrespondingtothePCRresult,therewasno ;RASSF1Aproteinincontrolgroupandvalproategroup, ;theRASSF1Aproteincouldbedetectedinhydrala

Report this document

For any questions or suggestions please email
cust-service@docsford.com