DOC

Study of relationship between VEGF expression and vasculogenic mimicry of tumor

By Louis Henderson,2014-02-18 23:44
6 views 0
Study of relationship between VEGF expression and vasculogenic mimicry of tumor

    Study of relationship between VEGF

    expression and vasculogenic mimicry of

    tumor

    ineseGermanIournalofClinicalOncology

    I10.1o07/s1033000901597

    November2009,Vo1.8,No.11,P655P6

    StudyofrelationshipbetweenVEGFexpression

    andVaSCUIOgeniCmimicryoftumor

    FangZhu,ZhenyuLi,JinghuaRen,GangWu,GangPeng

    DepartmentofOncology,UnionHospital,TongjiMedicalCollege,HuazhongUniversityofScienceandTechnology,

    Wuhan430022,China

    Received:14September2009/Revised:5October2009/Accepted:20October2009 AbstractObjective:TheaimofthisstudywastoexploretherelationshipbetweenVEGFexpressionandvasculogenic

    mimicryoftumorinvitro.Methods:WeobservedtheabilitytoformvasculogenicmimicryinsevereIcelllinesfoIlowasLO2

    cell.hepG2cell,SMMC-7721celIandA549ce?

    Inthree-dimensionalcultures;wedetectedtheexpressionofVEGFinlhe IevelofmRNAandproteinbypolymerasechainreaction(PCR)andwestemblotinthosecelIlines.Results:HepG2celIand

    A549ce?

    hadtheabilitytoformvasculogenicmimicryinthree-dimensionaIcelIcultures.whileLO2celIandSMMC.7721cell

    hadn'ttheability.TheratesofVEGF.16#GAPDHwere0.212?0.011.O.2080.013.0.117

    ?0.009and0.214?0.012respec.

1ively,andtheratesofVEGF121/GAPDHwere0.186?0.018,0.192?0.014,0.050?

    0.010,0.196?0.017InLO2cell.hepG2

    cell.SMMC-7721cellandA549cell,separately.TheexpressionofVEGFgeneinmRNAandproteinIevelsinHepG2cel1.

    LO2celIandA549ce?

    weresignificantlyhigherthanthatinSMMC.7721cellfP<0.05).Conclusion:ThecellIineswhichthe

    expressionofVEGFgeneisIowdon'thavetheabilitytoformvasculogenicmimicryandthehighexpressionofVEGFgene

    cann'tformvasculogenicmimicryatal1.whiletheexpressionofVEGFgeneinthecelIIinesishighinthecelllineswhichcan

    f0rmvasculogenicmimicry.VEGFhasimDacIontheformationvasculgenicmimicry.Onlylhecellswhichtheexpressionof

    VEGFishighhavethepotentiaItoformvasculogenicmimicry.But.1tdoesn'tplayauniquekeyroleinvasculogenicmimicry,

    KeywordsVEGF;tumor;vasculogenicmimicry

    Vasculogenicmimicry(VM)wascalledin1999by

    Maniotis[etwhoreportedtllatbloodvesselsof

    malignanteyeuumol"sknownasuvealmelanomasare

    formedbytumorcellsinsteadofendothelialcells,which

    wasreceivedwildspreadandconsideredasanovelcon

    ceptinthebiologyoftumorvascularization.Thepositive

    corretadonbetweenVMandprognosisoftumorwasre

    portedinmanystudies.Thenwhatistherelationshipbe

    tweenvasculogenicmimicryandangiogenesis?Vascular

    endothelialgrowthfactor(VEGF)isthemostimportant

    growthfactortoendothelialceilsinangiogenesis.Inthis

    study.wewilldetecttllerelationshipbetweentheability

    offormvascularchannelsandtheexpressionofVEGFto

    approachtheroleofVEGFintheformationofVM.

Materialsandmethods

    Cellculture

    ThehumanlungadenocarcinomacelllineA549,the livercancercelllineHepG2,SMMC7721andtheem

    bryolivercelllineLO2usedinthisstudywereobtained Correspondenceto:GangWu.Email:wugangzr@yahoo.com.cn fromthetabofDepartmentofoncologytheUnionHos

    pital,TongjiMedicalCollege,HuazhongUniversityof ScienceandTechnologyandmaintainedinRPMI1640 supplementedwith10%newbornbovineserun~(Gibco Biotechnology,USA).

    Three-dimensionalculture

    OnehundredpLoftypeIcollagen(3.0mg/mL,BD Biotechnology,American)werepreparedanddropped onto22cmgtasscoverslipsin6welltissuecultureplate.

    Thecollagenwasallowedtopolymerizefor30minat37 ?inahumidified5%C02incubator.TwomLofcom

    pleteRPMI1640mediumcontaining5x10'cellswere thenseededonthetopofthecollagengelandincubated at37?.Thenweobservedthemorphologicalchangesin thoseculturesbyinvertedmicroscopefor4days. RT-pCR

    IAwasextractedfromA549,HepG2,SMMC7721

    andL02cellsculturedonthetypeIcollagenthreedimen-

    sionalmatrixandreversedtocDNAusingTrizolreagent andMMLVreagentfInvitrogenLifeTechnologies,Inc., USA)followingthemanufacturer'sprotocols.PCRprim

    erofVEGFfforward5'CGAA(G((AGTTCAT

    656

GATG3'andreverse5'TTCTGTATCAGTCTTTCCTG

    GTGAG3'1wasdesignedaccordingtoWang[.VEGF wasnormalizedtothehousekeepinggene3glyceralde

    hydephosphatedehydrogenase(GAPDH),whosePCR primersweredesignedusingPrimarExpressSoftware. ThePCRconditionswerethesamefortwoprimers;the DNA.

    wassubjectedtoaninitialdenaturationstepfor5 minat94?.followedby35cyclesofdenaturationfor 30secat94?.annealingat54?or55?for30sec

    ondstoVEGFandGAPDH.separately.andextensionat 72?for30sec.Eachreactionwasthensubjectedtoa finalextensiontimeof10rainat72?.PCRproducts

    wereanalyrzedona2%agarosegelcontainingethidium bromideandvisualizedunderUVlight.Theresultswere analysedbyBandscansoftware.TheratiosofVEGF2/

    GAPDHandVEGF16?GAPDHwereconsideredtobethe

    relativeamountinthecellline.Theaverageofsixresults wasusedtostatistic.

    Westernblotanalysis

    TheproteinextractofA549,HepG2,SMMC7721and

    LO2ceilsculturedin3Dcultureswereobtainedbylysis thecellsinthecoldbufferinthepresenceofphosphatase inhibitorandproteaseinhibitorycocktail.Aftersubcel

    lularfractionation,equalamount(60)ofcytoplasmic fractionwereelectrophoresedin10%sodiumdodecylsul

    fatefSDS)polyacrylamide.Theseparatedproteinswere blottedontonitrocellulosemembrane,blockedwith5% Trissalinemilkandfollowedbyincubationwithprimary antibodies(VEGF,GAPDH,SantaCruz,USA)atroom

    temperaturefor1h.TheresultingIgGsweredetectedby incubationwithsecondaryantibodiesconjugatedtoHRP. TheECLchemoluminescencedetectionsystemandECL filmwereusedtovisuahzethepresenceofproteinsonthe celluloseblots.

    StatisticaIanalysis

    StatisticalsoftwareSPSS10.0wasusedintheanalysis. APvaluelessthan0.05wasconsideredstatisticallysig

    nificant.Differencesbetweentwogroupswerecompared usinganunpairedttest.

    Results

    ThedifferentabilitytoforlTIvascularchannels offourcelIlines'

    Fourcell1inesgrewadherentlytothewel1.Theshape ofL02cellshowedpolygonadherentin2dimensional

    culture(Fig.1a),whichwasthesameasthatin3dimen

    sionalculturescomposingoftypeIrattrailcollagen(Fig. 1b).TheSMMC7721cellshowedlongfusiforii1in2di

    mensionalculture(Fig.2a),whiletheshapechangedin 3dimensionalculturefFig.2b).Butitcouldn'tconnect witheachothertobevasculartube.TheaDpearanceof ?n)l,w.springerlink.corn/content/16139089

    Fig.1(a)L02cellsin2-dimensionalculture(xlOO);(b)L02cellsin 3-dimensionalculture(X100)

    Fig.2(a)SMMC-7721cellsin2-dimensionalculture;(x100);(b) SMMC?7721cellsin3-dimensionalculture(×100)

    Fig.3(a)A549cellsin2-dimensionalculture(x100);(b)A549cellsin

    3-dimensionalculture(×100)

    Fig.4(a)HepG2cellsin2-dimensionalculture(xlOO);(b)HepG2 cellsin3-dimensionalculture(x100)

A549cellandHepG2cellwasdifferentin2dimensional

    cultureand3dimensionalculture.In2dimensionalcell

    culture,A549cellandHepG2cellshowedlongfusiforill (Fig.3aand4a),whileitconnectedwitheachotherand formedvascularnetworksin3dimensionalcellcultures

    (Fig.3band4b).TheseresultsshowedthatA549celland HepG2cellhavetheabilitytofoITrlVMchannelsvitro,

    whileL02cellandSMMC7721cellhaven'ttheabihty.

    Theexpression0fVEGFinfourcelIIines

    detectedbyRT-PCR

    TheRNAextractedfromfourcellsculturedin3dcul

    turecultureinthe3rdday.TheexpressionofVEGFin fourcelllineswasdetectedbyRTPCR(Fig.5)andan

    ChineseGermanIClinOncol,November2009,Vo1.8,No.11 VEGF~65

    VEGF121

    L02HepG2SMMC7721A549bD

    451

    535

    403

    Fig.5TheexpressionofVEGFinfourcelllinesculturingin3-dimen

    sionalculturesweredetectedbyRT-PCR.TheexpressionofVEGFin SMMC.7721wasIowerthanlhatinothercellIines GSPDH

    LO2Hep~2SMMC-21A,54gKD

    vEGF——簟—瓣—一42

    

    羲鼍

    Fig.6TheexpressionofVEGFproteininfourcelllinesculturedin3?

    dimensionalcultureswasdetectedbyWesternblot.Theexpressionof

    VEGFproteininSMMC-7721waslowerthanthatinothercelllines alyzedbyBandscansoftware.TheexpressionofVEG

    F165mRNAandVEGF121mRNAinSMMC7721was

    lowerthanthatinL02,A549,HepG2celllines,signifi

    cantlyfP<0.05),whiletherewasn'tdifferenceintheex

    pressionofVEGFamongL02,A549,HepG2celllines(P >0.05;Table1,

    TheexpressionofVEGFproteininfourcell

    IinesdetectedbyWesternblot

    Theproteinextractedfromfourcellsculturedin3

    dimensionalcultureinthe3rdday.Theexpressionof VEGFproteininfourcelllineswasdetectedbywestern blot(Fig.5).ThegrayscaleofVEGFproteininSMMC

    7721waslowerthanthatinL02,A549,HepG2celllines, significantly,whiletherewash'tdifferenceamongL02, A549,HepG2celllines(Fig.6).Theresultwasthesame asthatdetectedbyRTPCR.

    Discussion

    In1971.Folkman[3proposedthehypothesisthattu

    motgrowthdependedontheangiogenesis.Fromthen ontheresearchoftumorangiogenesisstarted.Among theplentyofangiogenicfactors,VEGFanditsreceptor isrecognizedasthekeyfactorthatmediatesangiogen

    esis,whichpromotestheendothelialmitosisthusfinally Table1TheexpressionofVEGFinfourcelllinesdetectedbyRT-PCR 657

    formingnewbloodvessels.Itisthestrongestgrowthfac

    torthatstimulatesangiogenesis.Numerousclinicalre

    searchesrevealedthatthehighexpressionofVEGFwas closelyrelatedwiththemicrovasculardensityoftumor,

grademalignancyandthepoorprognosis'.

    In1993,Folberg7]foundthereticularformationwith

    positivePASstainingwhichpossessedthemicrocirculat

    edfunct.ioninmalignantmelanomawhichlocatedinpig

    mentallayerofhumaneye.Thereare7patterncomprised thereticularformation:simplestraighttube,parallel straighttube,simpleincompleteclosedloop,closedloop

    andnet.In1999.Maniotisconfirmedthatinthemela

    nomaofskinandpigmentallayerofeyesthereexisted thereticulartubewhichisPAS(+)CD34()formedby

    interactionbetweentumorcellsandextraceUularmatrix. Therewereredbloodcellsinsomeofthereticulartube whichindicatedthistubecouldprovidebloodtotumor tissues.Fromthenon,theconceptofvasculogenicmim

    icrywasproposed.Recentlytheclinicalresearchabout melanoma,hepaticcancer,breastcancer,esophagealcan

    cer,ovariancancerandprostatecancerdemonstratedthat vasculogenicmimicrywasnegativelyrelatedtotumor metastasis,invasivenessandprognosis[8-111.Thepropose ofvasculogenicmimicryfurthercompletedthetheoryof tumorbloodsupplyandgotmoreandmoreattention.As oneoffunctionalmicrocirculationoftumor,isitrelated toendotheliumdependentvesselintumortissue?Dose VEGFwhichcloselyrelatedendotheliumdependentan

    glogenesxsplayanequallyimportantroleinvasculogenic mimicry?CouldVEGFbecomethecollaborativetargetof antianglogeneslsandvasculogenicmimicry,

    VEGF165andVEGF121arebothimportantsubtypesof VEGF.Ourexperimentwasdesignedtoobservetheabili

    t,,ofvasculogenicmimicryinthe4kindsofceilsthrough

    3dimensionalcellculture.Atthemeantime,weapplied theRTPCRsemiquantitativemethodtotest?GF21

    and?GF165levelintheseceilsandprimarilyunderstood theeflfectofVEGFinvasculogenicmimicry.Theresults demonstratedthatlowexpressionofV.EGFcouldnot forillVMphenomenon,buthighexpressionofitdidnot necessarilyforrnVMphenomenon.Yettheceilsformed VMphenomenonrelativelyexpressedhighVEGF.Soitis postulatedthatVEGFplayscertainroleinVMformation andonlytheceilsthathighlyexpressesVEGFhavethe potentialtoformVM.ButV.EGFisnotnecessarilythe dependentkeyfactor.TheresearchofSun[12]indicated Inthisstudy,therateofVEGF165/GAPDHandVEGF121/GAPDHinSMMC-7721cellwas

    lowerthanthatinHepG2,LO2,A549cellssignificantly Comparedwithothergroups.P<O.05

    HIF1canspecificallybindtohypoxiaresponsiveele

    mentinthepromotorandenhancerofhypoxiagene,thus regulatingthetranscriptionoftargetgeneandpromotmg thevasculogenicmimicryformationinmelanoma.VEGF isincludedinthetargetgene.Underthestimulusofhy

    poxia,VEGFcooperatedwithothergenestopromotethe appearanceofVMwhichvalidatedtheeffectofVEGFin VMformationandagreedwithourresults.

    Accordingtoourresearch,itisestimatedthatvascu

    logenicmimicrymaybearesponseoftumortohypoxia duringthegrowth.Thequicklygrowingtumorneeds oxygensupplywhilehypoxiastimulatestheinteraction betweenplastictumorcells,thusformingvasculogenic mimicrywhichprovidesoxygentotumortissue.The highlyexpressedVEGFintumorcellsprobablyplay

    certainroleinvasculogenicmimicryformationinthese cells.Theearlystagedtumorcangetbloodsupplyfrom vasculogenicmimicrysothegrowthisaccelerating,then thehighlyexpressedVEGFfurtherpromotingtheforma

    tionofnewvessels.Inaddition,thestructuralspecific

    ityworsensthebarrierbetweentumorandbloodsupply, thereforeincreasingthepossibilityoftumorcellsgetting intobloodcirculationandmetastasisodds.Thisisinac

    cordancewiththeconclusionfromclinicalresearchthat thetumorpatientswithvasculogenicmimicryhadquick progress,earlymetastasisandpoorprognosis. TherelationshipbetweenVMandangiogenesisinthe developingoftumorremainsunclear.Manyscholarsex

    pecttofindoutsomecommontargetswhichcaninhibit theformationofVMandangiogenesisintumoratthe equa1pace.ThisstudyshowedusthatVEGFplayedrole intheformationofVM.Butitwasn'tauniquekeyfac

    torintheformationofVM.ManysubtypesofVEGFin

    cludingVEGF165bwhichcanspecialinhibitthefunction 0fVEGF165inangiogenesishavebeenreported.Which subtypeinVEGFplaysroleintheformationofVM?Is themechanismaboutVMformationthesameindiffer

    enttumors?Doesitplaythesameroleintheformation ofVMandangiogenesis?ThepreciseroleofVEGFinthe ?.springerlink.com/content/16139089

    formationofvMintumorsneedsadvancedresearch. References

    1.ManiotisAJ,FolbergR,HessA,efa1.Vascularchannefformationby

    humanmelanomacellsinvivoandinvitro:vasculogenicmimicry.Am JPathol,1999,155:739-752.

Report this document

For any questions or suggestions please email
cust-service@docsford.com