DOC

Prokaryotic

By Jim Stevens,2014-02-18 12:40
8 views 0
Prokaryotic

    Prokaryotic

    农业生物技术,2010,18,6,11631167

    JournalofAgriculturalBiotechnology,2010,Vo1.18,No.6,1163-1167 ALetter

    ProkaryoticExpressionofMouseSox2GeneandPreparationofIts

    PolyclonalAntibody

    LeiLeiCuiXinxinZhangShujinWangHuayan

    CollegeofVeterinaryMedicine,ShaanxiKeyLaboratoryofMolecularBiologyforAgriculture,ShaanxiCenterforStemCellEngineeringand

    Technology,No~hwestAgricultureandForestryUniversity,Yangling712100,China Correspondingauthor,hhwangl01@163.com

    DOI:10.3969/j.issn.16747968.2010.06.020

    AbstractSox2,oneofgeneswhichexpressinembryonicstem(ES)cells,playsanimportantroleinselfrenewal

    ofEScells,andisusedtomakeinducedpluripotentstemfiPS)cells.Inthisstudy,wesubclonedmouse(Mus

    muscules)full

    lengthSox2cDNAandinsertedSox2intopET.41aexpressionvector.Thentherecombinantvector

    wastransformedintoEscherichiacolBL21(DE3)cellstoexpressSox2fusionprotein.Theexpressedproducts

    wereidentifiedbyWesternblotusinganti

    GSTantibody.TheresultindicatedthatthesizeofSox2fusionprotein wasin61kD.AndtheproteinwasrecoveredfromtheSDS.PAGE.Andweusedthesox2fusionproteinto

    preparepolyclonalantibody.TheDotblowingresultshowedthattheanti

    Sox2antiserumhad1:12.800titers.1]he

antibodywillbeusefulforstudyingthefunctionofSox2anditsroleinEScellself-renewa1.

    KeywordsSox2,Expression,Antibody,Escherichiacoli Embryonicstem(ES)cellsarepluripotentcells derivedfromtheinnercellmass(ICM)ofearlyblasto. cysts,andarecapableofindefiniteself-renewaland propagation(Ivanovaeta1.,2006).Therefore,EScells candifferentiateintocelltypesofthethreegermlayers, andbeastheseedcellsapplyingfortheregenerative medicineandtransgenicanimals.Althoughtheplenty ofknowledgeonmouseandhumanEScellwereaccu

    mulated.scientistsarestilltryingtorevealthemolecu

    larmechanismswhichregulateEScellself-renewaland pluripotency.Thereareenormousnumberof~anscfip

    tionalregulationgeneswhichareinvolvedinthediffer

    entiationofEScells(EvsikovandSolter,2003;For- tuneleta1.,2003;RamalhoSantoseta1.,2002).Sox2

    geneclonedfrommousecDNAlibraryin1995by Yuan(1995),isoneoftheimpo~anttranscriptionfac. torswhichmaintainEScel1pluripoteney.The fu11lengthmouseSox2cDNAcontains2418bpse. quencewhichencodesa35kDprotein(CoUignoneta1., 1996).Recentstudiesshowedthattherewasagene regulatorynetworkinvolvedinmaintainingtheself-re

    newalandpluripotencyofEScells(Boyereta1.,2005). Tl1etranscriptionfactorsincludingOct4.Nanogand Sox2playanessentialroleinthenetworkandarere

    qukedforthepropagationofundifferentiatedEScells nvitro(Lobeta1.,2006;Avilioneta1.,2003;Nichols eta1..1998).Sox2alongwithOct4andNanoghaveal

    sobeenusedasthecorefactorstoinducefibroblasts

    becomingiPS(inducedpluripotentstemcel1)cellsin mouse,humanandotheranimals(Takahashieta1., 2006,Yu,eta1..2007).

    TostudytheSox2proteinfunction,wesubcloned themouseSox2geneandoverexpressedSox2protein inEcolcells.Theanti.Sox2antiserumwasproduced withtherecombinantSox2proteinpurifiedfromE.coli extracts.Thisworkprovidesausefultoo1forfutureto investigateSox2proteinfunctionsinESandiPScells. 1Resuits

    1.1SubcloneSox2geneandconstructionofvector DOI:10.3969/j.issn.1674-7968.2010.06.020 Foundationitem:ThisworkwassupportedbytheChineseNationalNaturalScienceFoundati

    on(No.30871786),ChineseNational

    Programs"973"(rio.2009CB941002)andthegrantofnewtransgenicmethodsandtechnolo

    gies(No.2009ZX08007-008B).

    Received:2010?02-11Accepted:20100930

4.h...

    By0.8%agrosegelelectrophoresis.thePCRprod- uctwasasinglebandwiththesizeof980bp(Figure 1A).Afterdoubledigestedbyrestrictionenzymes,the constructpGEM??T??Sox2showedasinglebandatabout 980bp(Figure1B).TheclonedcDNAwassequenced andalignedbyBLASTwiththepublishedsequence, showingthe99.9%identicalwithmouseSox2.Theex

    pressionconstructpET-41a-Sox2wasalsoconfirmed bythedoubledigestion(BamHI/SacI),whichasin- glebandat980bpwasobserved(Figure1c).

    bpM12bpM12bpM1

2000

    000

    750

    500

    250

    ABC

    Figure1IdentificationofmouseSox2genecloningand constructsofvector

    A,AgrosegelanalysisofPCRproduct,1:Negativecontrol,2: PCRproductofSox2cDNA;B,Restrictionenzymeanalysisof Sox2subcloneconstruct,Thevectorsweredoubledigestedby BamHJandSacJ.J:pGEM-T-Sox2vector;2pGEM-T.easy vector;C,RestrictionenzymeanalysisofpET-41aSox2,1:

    DigestionwimBamHIandSacI:M:DNAMarkerDL2,000 1.2ExpremionandidentificationofGS1'.-sOx2fh

    sionprotein

    TheexpressionvectorpET.41aencodestheGST peptidewithmolecularweightof26kD.Bytheinser

    tionofSox2fragmenttl1atencodeda35kDproteininto thedownstreamofGSTpeptide,theconstruct pET--41a??Sox2ispredictedtoexpressa61kDfusion protein.Theresultshowedthata6llDproteinband

    wasobservedintheIPTGtreatedsample.butabsentin noninducedsamplesandEcolicontrol(Figure2ar.

    row).Wefoundthattherewasnodistinctdifference causedbythedifferentconcentrationofIPTG,whilethe expressionlevelwassignificantlyincreasedin3~4hin. ductionvs.1-2hinduction,butnodifferentwith6hin. duction.TheWesternblowinganalysisshowedthat

    pET41atransformanthadthe26kDband(Figure2B, 1ane3),and61kDbandwasGST.Sox2fusionprotein (Figgure2B,lane1).However,belowthe61kDprotein, alowermolecularweightproteinbandwasalsodetect

    edbyGSTantibody(Figure2B,lane3).Wepredicted thatthelowerbandmightbecausedbytheinclusion bodiesrefoldingorpartialdegradationoffusionprotein. 1.3PreparationofSox2polyclonalantibody TheSox2fusionproteinwaspartiallypurifiedby thedifferentialcentrifugationwithvariousspeedsfrom 500gto8000g.Theresultsshowedthatbelow2000g, Sox2couldbestilldeterminedinthesupernatant,while over4000Sox2wasonlyinpallet,suggestingthat Sox2fusionproteinformedinclusionbodiesduring overexpressioninE.coli(Figure3A).Thepartiallypu

    rifledSox2fusionproteinwasseparatedby SDSPAGE.andstainedwithicecold0.5moI/LKCI

    (Figure3B).ThegelpurifiedSox2wasusedtogenerate polyclonalantibodies.TheDotblottingresultshowed thattheantiserumtiterreachedupto1:12800,suggest

    ingthatthispolyclonalantibodycouldbeusedinthe routineimmunochemistryexperiments(Figure4A), whilethenegativeserumcouldnotbeused(Figure4B). 2Discussion

    Recently,theinducedpluripotentstemcells(iPS) havebeensuccessfullyderivedfromsomaticcellsby theectopicexpressionofdefinedtranscriptionfactors, includingOCT4,SOX2,KLF4andcMYC(Takahshi

    andYamanaka,2006).However,theiPSmethodviathe

retrov~alintegratingvectorshasthepotentialforunex

    pectedgeneticmodificationsduringthetreatment. Thus,anewapproachwasfoundtogenerationofiPS cellsbyusingtherecombinantcell-penetratingtran

    scriptionfactors(Zhoueta1.,2009).Onemethodused tocircumventtheheterologousgeneexpressioninE. coliiscoexpressionofchaperoneswithproteinsofin. teresttofacilitatefoldingintoanactiveform,thereby yieldingamoresolubleform(GeorgiouandValax, 1996).Toobtainamoresolubleandactiveformof Sox2proteininEcoli.Kim'slaboratoryconstructeda fusionproteincoexpressingSox2withSkp,achaper. oneforprominssecretedfromtheinnermembraneto theperiplasmandtheoutermembraneofE.coli(Haet a1.,2009).Toinvestigatethefunctionandregulationof ProkaryoticExpressionofMouseSox2GeneandPreparationofltsPolyclonalAntibody116

    5

    kD

    lOO

    60

    47

    3l

    24

    14

    M123456123456l/2.1,2l/21/2l/2l,2

    A

    r:--

    i

    if||.!

    }'|.

}

    B

    Figure2SDSPAGE(A)andWesternblot(B)ofGST-Sox2 fusionprotein

    l~2:pET-41aSox2transformants;3~4:pET41atransformants;

    55:EcolBL2l(DE3)only;M:Proteinmarker;Thearrow indicatesthebandofSox2fusionprotein;1,3.5withIPTG induction;2,4,6withoutIPTGinduction

    l2345M6kD123456

    A

    l00

    60

    47

    31

    24

    l4

    B

    Figure3PurificationofSox2protein

    A,TheeelllysateswereconductedonSDS.PAGEge1.I: PartiallypurifiedSox2protein;25:Thesupernatantfractionsof celllysateseparatedbythecentrifugationat500,1000,4000and 8000g,respectively;6:Thecellpallet;M:Proteinmarker,B, PurificationofSox2proteinfromSDS-PAGEge1.Thepartially purifiedSox2proteinseparatedandstainedetherbyice-cold0.5 mol/LKCI(1-3),orbyCommassieblueR-250(4-6).The arrowsindicatetheSox2protein

    thetranscriptionfactorSox2,weclonedSOX2geneand constructedaprokaryoticexpressionplasmid.Toobtain thelargescaleproteinofSox2inE.coli,weusethepET vectorwhichisoneofthemostefficiencyexpression

    systemsinE.coliandcontainsaglutathionetransferase (csgenecassette.TheSox2eDNAisinsertedinthe downstreamofGSTcasseRetoformaGSTfusionpro

    teinwhichisdrivenbyanIPTGinduciblepromoter. ThehighlevelexpressionofGSTSox2fusionprotein

    wasdetectedafterthe4.hourIPTGinduction.Inaddi

    tiontheGSTSox2fusionprotein,weobserveda56kD

    proteinband(Figure2B)whichwasalsodetectedby GSTantibody.ThisGSTpositiveproteinmaybe

    causedbytheproteinasedegradationduringtheim

    properpreparationprocedure,ormaybecausedbythe 1/2l,2'1/2l,2l/2'01/2"A

    l/201/2/1/2l/21/21/25

    l/21/2'1,21/2l/2.1,2"B

    Figure4ThetitrationofantiSox2antibodyactivitybyDotblot

    PI9eelllysatesweredoubledilutedfrom20t02I1(thatisfrom1:l to1:4096).2Loflysateswereblottedonthenitrocellulose membrane.A,TheSox2antiserum(1:100dilutions)washybridized withmembranefollowingthemanufactureprotoco1.Thearrow showsthepositivedotwhentheantiserumisdjlutedintheworking concentrationat1:12,800.B,Thenegativeserum(1:100dilutions) aswellastheSox2antiserumhybridizedwimembrane

    incompletedenaturationofinclusionbodies.

    Oneofthemajorproblemsinproteinexpression

    usingheterologousexpressionsystemsistheformation ofinsolubleaggregates,suchasinclusionbodies.How

    ever,theformationofinclusionbodiescanhelptoiso

    latethetargetproteinbythecentrifugation.Topurifythe GSTSox2fusionprotein,wedidthedifferentialcen

    trifugations.Sox2-fusionproteinwaspelletedby>4000

    gcentrifugationandthenseparatedontheSDS-PAGE. Theconventionalmethodofinclusionbodypurification wastosolubilizeandrefoldtheprotein,andthenfurther topurify(Zhoueta1.,2009).Someresearchlaboratory (Zhangeta1.,2008)madepET28b-Sox2expressionvec

    torandpurifiedtherecombinantproteinbyNi.NTA affinitychromatographyandrefoldedoncolumnorby

    dialysis.Duetodenaturationandrenaturationcausing proteindegradationandtimeconsuming,wechoosea differentapproachtoisolateSox2fusionprotein.Inthis

    study,weselectedgel-purifymethodtogeneratethe Sox2-fusionproteinandtouseittogeneratethepoly?? clonalantibody.Basedonourexperimentalresults,this methodseemslikelytobeeasiertopurifytheantigen, especiallywhentheproteinexistsasinclusionbodies. Inthestudy,theDotblotwasusedtotesttheanti

    serumtiterwhichwasatechniquefordetecting,analyz

    ing,andidentifyingproteins.Itisaneasiermethodthan ELISAassayandmoreconveniencethanWestemblot

农业生物技术

    1166J

    oa10fAgricultLlralBi0techno10g),

    andimmunofluorescence.Theantiserumtiterreached uptOl:12800thatisestimatedsemiquantitatively,

    matoffersareferencedataforfurtherexperiment. Inconclusion.wehaveexpressedthehighlevelof Sox2fusionproteininE.colandusedthisproteinto producepolyclonalantibodiesagainstSox2protein. Theantiserumhasthesufficienttitertoapplyforthe

immunereactions.Inthefuture,wewillpurifytheanti

    serumviaGSTabsorptionandmaketheSox2affinity

    columntolargescalepurifySox2proteinthatcanbe usefulforESandiPScellresearch.

    3MaterialsandMethods

    3.1Materials

     EschcrichiacoliDH5ixwasfromourbiologylabora

    tory.pET41avectorandE.coliBL21(DE3)wereobmined fromDrGuoZekunfNorthwestA&FUniversity,China). DNApolymerase,dNTP,restrictionendonucleases,T4 DNAligaseandproteinmarkerwerepurchasedfromFer- mentasCompany(Lithuanian).Plasmidextractionkitand DNAmarkerwerepurchasedfromUGeneCompany

    (China).GelrecyclekitwaspurchasedfromBioDevTech

    Company(China).MouseantiGSTantibody,HRPcon

    jugatedgoatanti--mouseIgOwerepurchasedfromTian-- genCompany(China).ECLreagentwasfromPierce Company(American).Primersweresynthesizedby ShanghaiSangonCompany(China).DNAsequencing wasanalyzedbyBeOingSanboCompany(China). 3.2Sox2eDNAsubcloningandvectorconstruction AccordingtotheeDNAsequenceinGenBank

    (NM

    011443),wedesignedprimersforamplification full-lengthcodingregionofmouseSox2cDNA: Forward:5CCGGATCCATGTATAACATGLTGGAGACG3':

    Reverse:5'-CCCGAGCTCTCACATGTGCGACAGGG3.

    Tworestrictionenzymesiteswereinsertedintothe forward(BamHI,GGATCC)andreverse(SacI, GAGCTC)primerstohelpthesequencesubcloning.A

Report this document

For any questions or suggestions please email
cust-service@docsford.com