DOC

Prokaryotic Expression, Ascitic Polyclonal Antibody Preparation and Identification of Cashmere Goat Izumol

By Andrea Fox,2014-02-18 12:39
5 views 0
Prokaryotic Expression, Ascitic Polyclonal Antibody Preparation and Identification of Cashmere Goat Izumoland

    Prokaryotic Expression, Ascitic Polyclonal Antibody Preparation and Identification of

    Cashmere Goat Izumol

    AgriculturalSciencesinChina

    2010,9(4):605613

    Availableonlineat?,,^,vv,sciencedirect.com

    DirectApril2010

    ProkaryoticExpression,AsciticPolyclonalAntibodyPreparationand ldentificationofCashmereGoatIzumol

    LIUZhida,XINGWan-jin,WANGLianqingandLULixia

    KeyLaboratoryofMammalianReproductionBiologyandTechnolog~MinistryofEducation~SchoolofLifeSciences,InnerMongolia

    University,Hohhot010021,P.R.China

    Abstract

    Izumolisanovelmemberoftheimmunoglobulinsuperfamilylocatingonsperm,andisindispensableforsperm'egg

    fusion.Accordingtoitsimmunoglobulin

    likedomainintheextracellularregion,Izumo1wasfractionatedinto6fragments (F0F5)whichwereligatedwithpGEX

    4T1toconstructtheprokaryoticexpressionvectorspGEX?Fn.Therecombinant plasmidsweretransformedintoEscherichiacoliBL21(DE3)andtheGST-Fnfusionproteinswereexpressedsuccessfully

    byinductionwithIPTG.GST-FO,arecombinantfusionproteinofGSTwiththefu11lengthofextracellularregionofmature

    cashmeregoatIzumol,waspurifiedbypolyacrylamidegelslicingmethodandwasusedasanantigentoimmunizethe

Kunmingmousetogenerateanti

    GST-IzumolasceticpolyclonalantibodywithintraperitonealinjectionofS180cells. Subsequently,theanti

    GST-lzumolpolyclonalantibodywaspurifiedwithmiscellaneousantigenbyglutaraldehyde

    cross

    linkingmethod.Westernblottinganalysisshowedthatthepurifiedasceticpolyclonalantibodyhadhighaffinityto

    all6GST-Izumo1fragmentfusionproteins.Immunohistochemicalanalysiswiththisantibodydisplayedthatthecashmere

    goatIzumo1proteinswereattheequatorialsegmentofspermheadsurface.Theseresultsindicatethatthispolyclonal

    antibodyhashighspecificityandlaysthefoundationsforfurtherstudyontheexpressionpatternofIzumolincashmere

    goattestisandbindingabilitiesofeachextra

    membranefragmentofIzumoltotheeggsurface.

    Keywords:lzumol,cashmeregoat,prokaryoticexpression,polyclonalantibody INTRODUCTION

    Mammalianfertilizationconsistsofallintricatecascade

    ofcellcellinteractionsthatculminateinthefusionof

    spermandeggmembranesandformationofazygote.

    Despitetheimportanceoftheinteractionsthatleadto

    zygoteformationanddespitedecadesofresearch,the

    molecularbasisunderlyingwhichacrosomereacted

    spermatozoabindstoreceptormoleculesontheoocyte

    plasmamembraneandsubsequentlyfuseswiththeoo

    lemmaremainsunknown(SchultzandWilliams2005).

    Forfullyunderstandingthisevent,thekeymolecules

    Received25May,2009Accepted14July,2009

    CorrespondenceXINGWan-jin,Professor,E?mail:xwa~in@imu.eduell

    matmediatespermegginteractionsneedtoberevealed. however,onlyafewhavebeenshowntobeessential torspermeggunion.

    ResearchershadknownthattheIgdomainisimpli

    catedinsomaticcelladhesionandfusion,forexample, severalmembersoftheimmunoglobulinsuperfamily (IgSF)wereidentifiedtoberequiredformyoblastfu

    sioninDrosophila(Gallettaeta1.2004:ChenandOlson 2005).In2005,Inoueeta1.(2005)identifiedakey spermeggfusionproteinusingOBF13,amonoclonal antibodyagainstmousesperm(Okabeeta1.1988),and nominateditIzumofherewenameditIzumolforthe "Izumospermeggfusionprotein1precursor".This ~2010,GAAB.AllnghbreservedPublishedbyElsoviorI_kl 0oJ:101016.'$I671-2927(09)60135-8

    606LIUZhi.daetal

    findingshedslightonthedarkroadtowardsclarifica. tionofspermeggfusionmechanisms.

    IzumolisanovelmemberoftheIgSFwithanex

    tracellularimmunoglobulin-likedomain0glikedomain)

    andcontainsoneputativeNglycosylationsite.Itcan

    bedetectedontheequatorialregionofmouseandhu

    manacrosome?reactedspermheadsandisalsodetect-- ableintestisbyWesternblottingwithanti--Izumo1an-- tibody(Inoueeta1.2005).TheIzumol/malemice

    arehealthyandcanproducenormallookingsperms

    matcanbindtoandpeneuatethezonapellucidabutare incapableoffusingwitheggmembrane.Eggsinjected withIzumol-/-spermsimplantnormallyandtheresult. ingembryosdevelopappropriatelytotermwithrates

    similartothoseofheterozygousmice(Inoueeta1. 2005).ThisdemonstratesthatIzumo1isessentialfor sperm-eggfusion.Recentdiscoveriesthatmultiplepro- teindisulfideisomerasefamilymembersarelocatedat spermequatorialregionandcanaffectspermeggfusion,

    especiallyPdia3(ERp57)(Turanoeta1.2002;Ellerman eta1.2006),whichraisedthespeculationonthefunc

    tionofIzumolinspermeggfusionduringwhich

    IzumoImaybeanactivesubstratetoPdia3andits disulfidebondmaybecleavedbyPdia3tocausease. riesofconformationalchangethatfinallyfacilitates spermeggfusionasthewayinviromembranefusion (Nixoneta1.2007).However,fewdatawerereport onthistopicexceptforseveralonitspotentialusefor immunocontraceptiveantigen(Wangeta1.2008)and thefunctionofitsN.1inkedglycosylation(Inoueeta1. 2008).Itisstillunknownwhichligandoneggsurface isassociatedwithIzumolandwhetherIzumolissum

    cienttopromotegametefusionoriustacofactorthat facilitatesfusionorisinvolvedinmembraneattachment leadingtofusionbutnotnecessarilyabonafidefusogen. Cashmeregoatisusedasamajorsourceofwool

    andcashmere.butlittleresearchinthisareahasbeen doneinthislivestock.SincegoatIzumolanditsfunc

    tionareimportantforustounderstandtheregulatory aspectsofgoatfertilizationandreproduction,thefull lengthcDNAofcashmeregoatIzumolhadbeencloned inourlaboratory(GenBankaccessionno.EU627103). Inpresentstudy,weexpressedrecombinantgoat Izumo1fragmentsinEscherichiacoli,generatedas-

    citicpolyclonalantibodyagainstgoatIzumolandiden. tiffedlocalizationofIzumolinsperms.Theseresults willfacilitatethefurtherstudiesonIzumo1expression patterningoattestisanditsabilitytobindtotheegg surface.

    MATERIALSANDMETHODS

    medium,plasmids,andanimals

    E.colfDH5wasemployedasahostforthetransfor. mationandpropagationofplasmids.EcoliBL2l(DE31 wasusedforrecombinantproteinexpression.The pMD19.TvectorwasutilizedforthecloningofthePCR products.ThepGEX4T1plasmidwasemployedfor

    theconstructionoftheexpressionplasmidscontaining thecashmeregoatIzumo1cDNAfragments.E.coliceils harboringtheplasmidsweregrowninLuria-Bertani(L,B) mediumsupplementedwith100mLofampicillin.

    Kunming(KM)micewereusedtoprepareascitic polyclonalantibodybyceliacinjectionofS180cells. FreshsemenofcashmeregoatwascollectedinInner MongoliaWhiteCashmereGoatBreedingFarm.China. PrimersandPCRamplificationofgoatIzumol cDNAfragments

    cashmeregoatIzumo1cDNA(GenBankaccessionno. EU627lo3)iscomposedof978bpandcontainsan openreadingframe(0RF)of963bpwhichencodesa peptideof320aminoacidresidueswithanimmuno

    globulin.1ikedomainintheextracellularregion.PCR amplificationsof6fragments(F0F5)oftheeDNA

    regionthatspecifytheextracellularregionofgoat Izumo1(Fig.nfromatemplateplasmidcontainingthe

fulllengthcDNAofgoatIzumo1(storedinour

    laboratory)wereperformedwith6pairsofoligonucle

    otideprimerscontainingEcoRIorBarnHIsites.The

    primersarelistedasfollows: P1:5,-CGGGATCCAGGGGCTGTGTCATT TGTGA3(BamHI1:

    P2:5,_CGGAATTCGCGCTTTCCGCAATTCTT AGA3(EcoRI):

     P3:5,_CGGGATCCAAGCGCGAAGTCAAG(H?

    CATC.3(BamHI);

    P4:5,-CGGAAGGGCAATACTGTGAC

    GT_3(EcoRI1:

    (~2010.CAAS.Allaghtsreserved.PublishedbyElsevierLtd.

    ProkaryoticExpression,AsciticPolyclonalAntibodyPreparationandIdentificationofCash

    meo!mo607

    Izumo1N

    F0

    Fl

    F2

    F3

    F4

    F5

    SP

    rL_,

    122

    Ig-likedomain

    l6l252

    TM

    r

    3Ol320aa

23

    23

    23

    

    ?

    PlP2P3P4P5P6

    162

    162

    16I

    252

    3O1

    3O1

    [======]252

    253=]301

    Fig.1TheschematicdiagramofgoatIzumolpeptide.SP,the

    signalpeptide;TM,transmembranedomain.F0F5are6fragments tobeamplified.P1P6andthearrowsareprimersdesignedto amplifythesefragments.

    P5:5C(;A'I'UCUAAAAGAlCAUGA(j

    GA3(BamHI);

    P6:5"-CGGAATTCGCGTCTTCTCAGCAG

    TTGCTC3(EcDRI,.

    PrimersP1andP6amplifytheF0(843bp),P1and P4theF1(708bp),P3andP6theF2(402bp),P1and P2theF3(447bp),P3andP4theF4(267bp),andP5 andP6theF5(141bp).Reactionswerecarriedoutin athermalcycler(Biometra,Germany)underthecon

    ditionsofaninitialdenaturationat94.Cfor3minfo1. 1owedby35consecutivecycles(denaturingfor30sat

94.C.anneallingfor30sat5759.Cdependingonthe

    meltingtemperature(Tin)oftheprimerpairs,andex

    tendingfor1minat72.C1andthefinalextensionat 72.Cfor10minusingrTaqDNApolymerase(TaKaRa. Japan).Foreachpairofoligonucleotideprimers,the annealingtemperaturewaschosentoobtainonesingle amplificationproduct.PCRproductswerethenana. 1yzedbyelectrophoresison1%agarosege1.andbands wereexcisedandpurifiedusingtheAxyPrepDNAGel ExtractionKit(Axygen,USA),thenwereinsertedinto pMD19Tvector(TaKaRa,Japan)forconstructionof therecombinantplasmidspMD-Fn(Fnrepresents6 fragmentsofgoatIzumo1,F0-F5).

    Constructionofprokaryoticexpressionvectors TherestrictionenzymesEcoRIandBamH1wereused todigestpMDFntoisolatethe6fragments.TheF0

    F5wereligatedwithlinearizedpGEX4T1vectorto

    constructexpressionvectorsinwhichtheinsertedFn fragmentswerefusedinframewithGSTnucleotides

    sequence.ThecompetentE.coliDH5t~cellswere transformedbytheligationmixturesandpositiveclones ofpGEXFnwerescreenedbyPCRandconfirmedby sequencing(TaKaRa,Dalian).

    ExpressionoftheGST-Fnfusionproteinsand SDS-PAGEanalysis

    OvemightculturesofE.coliBL21(DE3)transformants weredilutedintoLBmediumsupplementedwith100 lagmL.ofampicillin(Sigma,USA)andallowedtogrow at37.Catastirringspeedof250r/min.Whencell

densityreaches0.40.6at0D6oo,IPTG(isopropyl

    B.Dthiogalactoside,thefinalconcentrationwas100 lagmL1wasaddedtothemediumtoinduceexpres

    sionofGST-Fnfusionproteinsfor4h.Afterinduction, cellpelletswerecollectedbygentlecentrifugationand resuspendedin40uLofsterilewaterand2xsample buffer(0.1molLTris.HClPH6.8,10%B.2

    mercaptoethanol,4%SDS,20%glycerol,and0.1% bromphenolblue)(1:1),thendisintegratedbyrepeated sonicationonice.boiledfor5minat100.Candana

    lyzedby12%sDSpolyacrylamidegelelectrophoresis (PAGE1.Theuninducedcontrolcultureandthevector controlculturewereanalyzedinparalle1. WesternblottinganalysisofGSTFnfusion

    protein

    ToidentifytheGST-Fnfusionproteins.Wlesternblot

    tingwasperformedasdescribedpreviously(Zhang fa1.2008).Theproteinsonthepolyacrylamidegel weretransferredelectrophoreticallyontoPVDFmem. branes(polyvinylidenedifluoride)(Solarbio,Beijing, China).Afterblockingwith5%skimmedmilkinTBS

    0.05%Tween20(TBST)overnightatroomtempera

    ture(RT),themembraneswereincubatedinananti

    GSTmonoclonalantibody(Tiangen,Beijing,China)ata dilutionof1:1000for1hatIThemembraneswere washedtwicewithTBSTfor10mineachtime.The immunoreactiveproteinbandsweredetectedwithhorse

    radishperoxidaseconjugatedgoatantimouseIgG(Bios,

    Beijing1dilutedatl:1000inblockingbufferassecond

    aryantibodyfor1.5hatRFinally,afterbeingwashed

    threetimesasabove,themembraneswerevisualized usingDAB(diaminobenzidine)(Sangon,China). @2010.CAASAllfightsreservedPublishedbyElsevierLtd 608LIUZhidaetal

    PurificationofGST-F0fusionprotein

    ThewholeextracellularregionofmatureIzumol(F01 wasusedasanimmunogentogenerateantiIzumol

    asciticpolyclonalantibody.Thebacteriacellsharbor- ingpGEXF0wereinducedandharvestedfrom3L

    culturebycentrifugation.Thecellpelletswerere

    suspendedwith4timesthevolumeofsterilewater and2xsamplebuffer(1:1),andsonicatedonice(15

    20cyclesof6son/14soff).Thentotalproteinwas separatedby10%SDSPAGE.Atierelectrophoresis.

    thegelwassoakedinprecooling0.5molL'KClfor3- 5minuntilmilkybandsappeard.TIletargetbandwas excisedaccordingtotheprestainedproteinmarker (Fermentas,Shenzhen,China),thenminced,putintoa dialysistubingforelutionbyhorizontalelectrophoresis undertheconditionsof60Vovernightor100Vfor3 h,withafinalelectrodereversionfor5min.Thegel dregswerediscardedandelutedproteinsweredialyzed againstPBS(O.01molL.pH8.0)for24handconcen

    tratedwithpolyethyleneglycol(PEG)20000at4.C. einspissatedproteinsweresubjectedtoanotherpro

    cedureofelectrophoreticseparationandelution.Con

    centrationofthepurifiedfusionproteinwasmeasured bytheBradfordmethod.

    Preparationandpurificationoftheascetic polyclonalantibodies

Report this document

For any questions or suggestions please email
cust-service@docsford.com