DOC

ANP T2238C, C-664G Gene Polymorphism and Coronary Heart Diseasein Chinese Population

By Audrey Ferguson,2014-02-17 20:26
8 views 0
ANP T2238C, C-664G Gene Polymorphism and Coronary Heart Diseasein Chinese Population

    ANP T2238C, C-664G Gene Polymorphism

    and Coronary Heart Diseasein Chinese

    Population

    528

    JournalofHuazhongUniversityofScienceandTechnology[MedSci]26(5):528

    530.2006

    华中科技大学r医学(英德文)]

    ANPT2238C,C-664GGenePolymorphismandCoronaryHeart

    DiseaseinChinesePopulation

    zHANGLiyun(张利芸)',CHENGLongxian(程龙献),HEMeian(何美

    ):,HUBinchang(胡丙长),

    wuTangchun(邬堂春)

    InstituteofCardiovascularDisease,UnionHospital,TongjiMedicalCollege,HuazhongUniversityofScienceandTechnology,

    Wuhan430022,China

    InstituteofOccupationalMedicine,TongJfMedicalCollege,HuazhongUniversityofScienceandTechnology,Wuhan430030,

    China

    Summary:Theassociationbetweenatria1natriureticpeptide(ANP)polymorphismandcoronary

    heartdisease(CHDwasstudiedinChinesepopulation.ThegenotylcIesofANPT2238CandANP

    C

    664Gweredetectedbypolymerasechainreactionandrestrictionfragmentlengthpolymorphism

    fPCR

RFLPmethodsinl58consecutiveCHDpatientsandl65controls.Itwasfoundthatthedis

    tributionofA2A2genotypeinCHDgroupwassignificantlyhigherthanthatincontrolgroup (P<0.05).StepwiseLogisticregressionanalysisrevealedthatmale,smoking,historyofhypertension,

    historyofdiabetes,familyhistoryofhypertension,highlevelofserumcholesterol,andANPT2238C

    polymorphismwerethepossibleriskfactorsinpatientswithCHDrP<0.05).HoweveLtherewasno

    significantdifierencebetweenthepatientswithCHDandthecontrolgroupinthedistributionofANP

    C

    664GpolymorphismfJD>0.05.TheresultssuggestthatA2A2T2238Cgenotypecouldbeoneof

    theriskfactorsforCHD(P<0.05,0:1.80,95%C,:1.033.15).

    Keywords:coronaryheartdisease;atrialnatriureticpeptide;polymorphism DoIl0.1007/sl159600605l0v

    CoronaryheartdiseasefCHD1isoneofthemost

    commoncardiovasculardiseases,whichisassociated

    withmanyfactorsandhasobviousfamilialaggregations;

    AmericanHeartAssociationfAHA1consideredthathe

    reditywasoneofthemainriskfactorsofCHD"1.Itis

    importanttodetectthesensitivegenesforunderstanding

    thepathogenesis.preventionandtreatmentofCHD.

    AtrialnatriureticpeptidefANP1isacirculating

    hormonemailysynthesizedinthecardiacatria,thebio

    1ogica1actionsofwhichincludepromotionofnatriuresis

    andvasodilatation,suppressionoftheren

    ninangiotensinaldosteronesystem(RAAS,and

    othervasoactivesubstancessucha

    .

s

    ,

    vasopressin,cate

    cholamineandendothelin1(ET1)I.Inaddition,ANP

    suppressedmitosisinmanycellmodels,includingvas

    cularSMCandvascularendothelialcells.Moreand moreevidencesindicatethatANPplaysanimportant roleincoronarybloodflowregulation

    Therefore,itcanbehypothesizedthatANPcouldbe associatedwiththeocurranceanddevelopmentof atherosclerosisandCHD.andthatthehumanANPgene maybeapotentialcandidategenecontributingtotherisk ofCHD.Thisstudyinvestigatedthepossibleassociation betweentheANPT2238CandC664Gpolymorphisms

    andCHD.

    ZHANGLiyun,female,bornin1979,Postgraduate Correspondingauthor

    ThisprojectwassupportedbyagrantfromNationalNatu ralSciencesFoundationofChinafNo.30128021. 1MATERIALSANDMETHoDS

    1.1SuMects

    Theinvestigationwassupportedby3generalhos

    pitalsinWuhancity,HubeiProvince,China.A11patients withCHDwereadmittedinthe3hospitalsbetweenNov. 11.2002andMarch19.2003.Thestudygroupwas separatedintotwogroups:

    A.Controlgroup:165nonCHDvolunteersfmale~

    67,female:98,averageage:63.2?7.1years),havingno

    kinshipwitheachother.AndthepresenceofCHDwas ruledoutfollowinghistory,physicalexaminationand

electrocardiogramfECG1amongthem.

    B.CHDgroup:158randomlychoosencaseswho

    wereinhospita1betweenNov.10.2002andMarch19. 2003withCHDfmale:99,female:59,averageage: 65.0?6.5years),includingpatientsofunstableangina andmyocardialinfarctionfMI),havingnokinshipbe

    tweeneachother.CHDwasconfirmedbymeansofan

    giographyfdefinedas?50%stenosisinatleastone

    coronaryartery).

    1.2Investi2atiOn

    Casegroupandcontro1groupwereinvestigatedac

    cordingto''MolecularepidemiologyofHypertension andCoronaryHeartdisease"questionnairefsupportedby professorHuBinchang.fromPublicHealthInstitute. HarvardUniversity,USA),itemsofwhichincludedgen. eralconditions,smokinghistory,historyofalcohol,past history,andfamilyhistoryetc.Bloodsampleswereco1. 1ectedonthemorningoftheprocedureafter12hfasting

    period.Heparinwasusedasanticoagulantinthecollec.

52t)

    tiontubeandalIthesampleswere8LOlcdat-8()L'. I-3GeneticDetectionofANIT2238C(Soal1and ANPC.664G(RsaI)I,dymorphisms

    l_3.1PreparationofDNATemplateDNAwascx

    tractedrrom300|tLol'blolxlsampie.accordingIc_the specificationnfPUREGENEDNAextlactlcIntestkIl l_3.2PolymeraseChainReactinn(PCR)ofANP

    T2238C{ScaIlPolymorphismACOOld1r0gtothe

    methodinIiteraturerecord.R,liendranathRatalagawlll'~. 1992Thepdn2el-:5.GGCACA(r('ATACA

    GAAGCTGACnTr3..5'GCAG_rCTGTCCC

    TAGGCCCA3.(SvnthesizedbySBSbjoloeicaJ prtxluctscorporationChinaPCRWaSperformedli1a

    25uLreactiond'tin-recontaining1Il?ofDNA.O.5iiL

    of4×dN_rP(10mmol/L).25LLofl】×PCRBLIfie].1

    vLofeachofthetwostrandpriillersIl0pillilllllL)25 pLofMgCI,(25n~rnol).U[fAmpli-TaqDNAPo

    lymerase(Jingmeibiologicalprodnctscorptnation, China).towhichwasaddedddH0uDl025uLofLolll volume.PCRwasperE)rmedinPCRll_StlumentfEp

    pendorft.USA)Thelnltia1denatul'atit?w4minat

    94.C'wa~fowedbv33cvcesoidenatnratl1t3()

    at94C,annealingfor60at62'C.extensi~m"1r6f)at 72C.andfinalextensionfor10rainat72o(. 1.3.3PCRofANPC-664(;(RsaIIPolymorphism Accordingtothehietht)djnlIteraturerecordThe primer:5.AACAGCAACGGAAGAAATGA3..

    5'ATCCAACCCCCAAATAGAAGTA3'

    (SyntheszedbySBSbio1ogicalDr(xLIe[Scorpolation.

    China)pCRwaspel'f.medi11a25pLIeact1onvoJLime PCRwasperlbrmedasthesameiiiI32.

    1j.4DetectionnfRFLPs1_heairnfragnlentswele digestedwithScaandRsa1Baoshengwuhie-

    ogicalcompany',ChinarespectivclvAndtilel'e~tlltins fragmentsridentcationwereseparatedonI5md 18%polyacrylam1deetlnderconstartt60Velect'o-

    phoresisrespectively

    2RESULTS

2.1ClinicalCharacteristiesofCHD

    Thel_esuhswereshowtlntable

    Table1Baselineclinicaldataofthestud)'suhiees 2.2Resultsol.Electrophoresisot.ANPT2238C P.)lymorphismandANPC664Gllymnrphism

    ANPT2238CgunotypcwasdetectelIaseither A2A2presenceof21estrictlonsitesonb')thal_e1es)or AlA2(absenceotreslrictic,n】【c'1nlaIlele)A2A2

    genolypehad2eJeclr(phoreticzosters77bpand56bp)

    AIA2gcnotypehad3elec[rnphoretlz+Stersc33bD.77

    bpand56b)(fig1]ANPC664Ggenotypewasde

    tectodaHeitherCC(absenceorrestiLctionsite0nboh

    Lc1es)nlCG1abseneeollrestrictionsiteonla_ee1

    TheGgenotypeshotlldllave3ecutroph<)rutlczosters f1S7b.134hpand23bp1I!utonlv2elecu.ophoretic zosterswereldent?e[I^)ftlleelectlophotctjccnndition AndCCgenotypehad111electropholc1lc;,osier' 57bDffig2J.

    131

    77

    Fig-1Therestl[tt)feleclrophoresisofANPF2238Cpoly illorpllINln

    M:DNAladder

    bP

    00

    4Of)

    20O

    1O0

    5cJ

,CC

    Fig+2Theresulloldecm)phoresis_11ANPC-664Gpoly- mllq}llisti1

    M:DNAladder

    2.3DistrihutionsofANPT2238Cpolymorphism andANPC664Gpolymarphism

    ThedistributionofANPF2238Cpolymorphism amongtolaSttldypt)pulatioi1wsseenittane2./test

    revealeddmtthedi,;tIbuttonfrequencyorA2A2genc> type1J1CHDgroupwassignificant13'highmthanthatin controIgroupIP<O.05J.ThedistlibntionofANPC6MG

    D)lymorplnisma

    ,

    lnon

    

    RiotalstudypopulationWasseenin

    tablc3Withtest,itwag1trendthatl1erewant)sig

    aifican[dIfferencehetg~..eentheCI?)groupandtheCOn

    troIgroupiI1thedistributionoiANPC664Gpol3mmr

    Dhjsnlf,]>()05l

    2.4Stepwi~logisticregressionanalysisofJ.iskfac. torsnfCHD

    lnastepv,lselogistic

    f"OftheriskfacOIS0ICHD

    regressionme,teladjusunent

    theORfi)rtileassociationof

    A2A2genotypeandOL'UUrrerlce'1rCHDwa^l80f95%? CI,1.0293I49)Noasst~iationbetweenC664G

    D)I}qnorphismandoccurrenceolCHDWaSfound<table 4)

530JournalofHuazhongUniversityofScienceandTechnology[MedSci]26(5):2006

    Table2TheANPT2238Cgenotypefrequencyofsubjects P<0.05

    Table3TheANPRsaI(C-664(;)genotypefrequencyof subjects

    Table4TheLogisticregressionmodelincludingthema- jorriskfactorsinCHD

    B:Regressioncoefficient;Gender:Male=1.Female=0; Smokinghistory:True=1,False=0;Historyofhypertension: True=1,False=0;HistoryofDM:True=1,False=o;ANP T2238Cgenotype:A2A2=1.A1A2=O;ANPC-664Ggenotype: CG=I.CC=O;P<0.05."P<0.0l

    3DISCUSSlON

    Inhumanbeings.theT2238Cpolymorphismislo

    catedonastopcodonofthegeneforANP.Becauseof T2238?Ctransitionwithinastopcondonleadingtothe extensionofthehANP.thepeptideof28aminoacidsis extendedto30aminoacidsby2additionalarginines)J.

    OurstudyindicatedthatthefrequencyofA2A2T2238C genotypewas42.11%,AlA2genotype57.89%.and A1A1genotype0.00.111efrequenciesofA1andA2al

    leleswere30.02%and69.98%respectively.Thedis

    tributionfrequencyofA2A2genotypeinCHDgroup wassignificantlyhigherthanthatincontrolgroup fP<0.05).Theresultsweredifferentfromthosereported byRajendranathetalinthestudyontheANPT2238C polymorphismamongCaucasian,Africanblacksand MauritiusIndian(yellowrace).Aninvestigationabout hypertensionofJapanesebyKatoetalrevealedthatthe

    distfibutionfrequenciesofA1andA2alleleswere2% and98%respectivelyintheirstudypopulationI4J. An

    otherlarge-samplestudyreferringtowhitesinPoland areaindicatedthatthedistributionfrequenciesofAland A2alleleswere60%and40%respectivelyintheir studypopulationoJ.Inconclusion.thedistributionsofthe genotypeweredifferentbetweendifferentraces. ThestudyontheassociationbetweenANPT2238C genepolymorphismandCHDbyGruchalaetalimp" pliedthattheA2A2ANPT2238Cgenotypewasoneof theabsoluteriskfactorsofoccurrenceofCHDinPolish. ThisstudyfoundthatsubjectswithA2A2genotypehad higherincidenceofCHDthanthosewithA1A2geno- type.

    However.theabsoluteassociationbetweenANP T2238CpolymorphismandCHD.andthemechanisms involvedwerestillobscure.Paststudieshadprovedthat theincreaseofserumANPlevelhadaprotectiveaction oncoronaryatherosclerosisandalsoinhibitedcoronary arteryspasm.SomeresearchersconsideredthattheANP T2238CgenotypesinfluencedtheexpressionofANP. Itwasproventhatischemiaandhypoxia.which wereimportantinthepathophysiologyofCHD.influ

    encedthetranscriptionofANPgenedirectly.Paststudy indicatedthatANPgenewasahypoxiareactiongene.

    andthereweretwoareasoffunctionalimportancein 5'UTR.ANPC664Gisiustincludedinoneofthese areas.ItwasreportedbyKatathatthedistributionfre

quenciesofCandGalleleswere98%and2%respec

    tively,andtheGallelewassignificantlyassociatedwitll theoccurrenceofhypertension.Inthisstudy,theresults indicatedthatthedistributionfrequencyofGallelewas 2.01%amongthewholestudysubiectsandthatofC allele97.99%.ThedistributionfrequencyofCGinCHD groupwashigherthanthatincontrolgrpup.butwithout significance(OR1.23,95%C,0.403.73.P>0.05).

    Thepolymorphismwasexcludedfromthemodelby

    multiplelogisticregressionanalysis.Itwasconcluded thattheadjustmentofANPC664Gpolymorphismfor

    theexpressionofANPwasmininalandwasnotenough tobetheriskfactorofoccurrenceofCHD.

    REFERENCES

    lScottM.GaryJ.MichaelHeta1.Primarypreventionof coronaryheartdisease:Guidancefromframingham.Cit- culation.1998.97:l876-l890

    2NishikimiT.MoriY.IshimuraKeta1.Associationof plasmaatrialnatriureficpeptjde,N.terminalproatrialnatri

    ureticpeptide.andbrainnatriureticpeptidelevelswith coronaryarterystenosisinpatientswithn0rInalleftven- tricularsystolicfunction.AmJMed,2004,l16(8):517.523 3TakagiG,KiuchiKEndoTeta1.Alpha.humanatrial natriureticpeptide,carperitide,reducesinfarctsizebut notarrhythmiasaftercoronaryocclusion/reperfusionin dogs.JCardiovascPhIarmacol,2O00,36(1):22.30 4KatoN,SugiyamaT,MoritaHeta1.Geneticanalysisof theatria1natriureticpeptidegeninessentialhypertension. ClinSci.2000.98:251.258

    5MasharaniU.NakashimaPF.LimDWefa1.NsiIand

Report this document

For any questions or suggestions please email
cust-service@docsford.com