TXT

Engineering of a Xylose Metabolic Pathway in

By Ricky Hall,2014-08-25 18:39
6 views 0
Engineering of a Xylose Metabolic Pathway in

     ??ÎÄÓÉvcxz2255??Ï×

    pdfÎĵµ?ÉÄÜÔÚWAP?Ëä?ÀÀÌåÑé???Ñ????ÒéÄúÓÅÏÈÑ?ÔñTXT???òÏÂÔØÔ?ÎÄ?þµ????ú?é????

     APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2006, p. 3418?C3428 0099-2240/06/$08.00 0 doi:10.1128/AEM.72.5.3418?C3428.2006 Copyright ? 2006, American Society for Microbiology. All Rights Reserved.

     Vol. 72, No. 5

     Engineering of a Xylose Metabolic Pathway in Corynebacterium glutamicum

     Hideo Kawaguchi, Alain A. Vertes, Shohei Okino, Masayuki Inui, and Hideaki Yukawa* `

     Research Institute of Innovative Technology for the Earth, 9-2 Kizugawadai, Kizu-cho, Soraku-gun, Kyoto 619-0292, Japan

     Received 5 December 2005/Accepted 8 March 2006

     The aerobic microorganism Corynebacterium glutamicum was metabolically engineered to broaden its substrate utilization range to include the pentose sugar xylose, which is commonly found in agricultural residues and other lignocellulosic biomass. We demonstrated the functionality of the corynebacterial xylB gene encoding xylulokinase and constructed two recombinant C. glutamicum strains capable of utilizing xylose by cloning the Escherichia coli gene xylA encoding xylose isomerase, either alone (strain CRX1) or in combination with the E. coli gene xylB (strain CRX2). These genes were provided on a high-copy-number plasmid and were under the control of the constitutive promoter trc derived from plasmid pTrc99A. Both recombinant strains were able to grow in mineral medium containing xylose as the sole carbon source, but strain CRX2 grew faster on xylose than strain CRX1. We previously reported the use of oxygen deprivation conditions to arrest cell replication in C. glutamicum and divert carbon source utilization towards product production rather than towards vegetative functions (M. Inui, S. Murakami, S. Okino, H. Kawaguchi, A. A. Vertes, and H. Yukawa, J. Mol. ` Microbiol. Biotechnol. 7:182?C196, 2004). Under these conditions, strain CRX2 ef?ciently consumed xylose and produced predominantly lactic and succinic acids without growth. Moreover, in mineral medium containing a sugar mixture of 5% glucose and 2.5% xylose, oxygen-deprived strain CRX2 cells simultaneously consumed both sugars, demonstrating the absence of diauxic phenomena relative to the new xylA-xylB construct, albeit glucose-mediated regulation still exerted a measurable in?uence on xylose consumption kinetics. Ethanol and most biochemicals are currently typically produced by converting the hexose sugars contained in corn starch or sugarcane syrup. However, these feedstocks are relatively expensive

    and have a competing value as food. On the other hand, lignocellulosic biomass from agricultural waste represents an abundant and cost-effective renewable energy source that is to date underutilized. This material thus represents a promising candidate as an alternative substrate for the biotechnological production of commodity chemicals. Lignocellulose is composed mainly of cellulose (40 to 50%), hemicellulose (25 to 30%), and lignin (10 to 20%) (54). Lignin is a noncarbohydrate polyphenolic compound. Cellulose hydrolysates comprise glucose and various levels of cellobiose and other glucose oligomers. On the other hand, hemicellulose hydrolysates are more complex mixtures as they include several hexoses (glucose, galactose, and mannose) and pentoses (xylose and arabinose) (53). Despite the fact that typical lignocellulosic carbohydrate fractions are composed primarily of glucose, typical pentose fractions represent a nonnegligible portion of the sugar fraction of lignocellulosic biomass, as they reach the 5 to 20% range for xylose and 1 to 5% for arabinose (1). As a result, the capability to ef?ciently utilize pentoses is a key attribute of microbial converters for optimizing the economics of lignocellulose-based processes (28). Several fungi and bacteria have been shown to grow aerobically on xylose, but relatively few wild-type strains can utilize xylose as a fermentable substrate (21). While recent extensive research efforts have been made to develop ef?cient industrial biotechnological schemes for

     * Corresponding author. Mailing address: Research Institute of Innovative Technology for the Earth, 9-2 Kizugawadai, Kizu-cho, Sorakugun, Kyoto 619-0292, Japan. Phone: 81-774-75-2308. Fax: 81-774-75-2321. E-mail: mmg-lab@rite.or.jp. 3418

     deriving useful products from lignocellulose (52), the bioconversion of xylose remains a limiting step (8, 22, 48). The lack of industrial microbial biocatalysts with improved properties thus constitutes a major bottleneck to the implementation of successful industrial processes using lignocellulosic biomass as their primary feedstock. The nonmedical corynebacteria are gram-positive bacteria that belong to the Actinomycetes subdivision of Eubacteria. Corynebacterium glutamicum has been widely used for the industrial production of various amino acids and nucleic acids (24, 47). We previously demonstrated that, in mineral medium and under conditions of oxygen deprivation, this aerobic bacterium is essentially under bacteriostasis but maintains its main metabolic capabilities and is thus able to excrete in signi?cant amounts several metabolites, such as lactic, succinic, or acetic acids, while cellular growth is essentially arrested (20). The arrest of cellular replication enables the organism to limit by-product generation and reach higher productivities, since most of the carbon source can be channeled towards

    product production rather than towards vegetative functions. Combined with the use of a reactor ?lled to a high density with cells derived from aerobic culture, these features led to a bioprocess with high volumetric productivity. The unique properties of C. glutamicum under oxygen deprivation were exempli?ed by lactic acid and ethanol production (19, 34). Commonly used substrates in industrial production by C. glutamicum include sucrose- and glucose-based media. However, the use of xylose-based media is currently not possible, owing to the inability of C. glutamicum to metabolize this sugar (7). As discussed above, xylose utilization is an important trait for an economically feasible production of ethanol and commodity chemicals from lignocellulosic biomass by microbial

     VOL. 72, 2006

     XYLOSE METABOLISM IN CORYNEBACTERIA TABLE 1. Strains and plasmids used in this study

     3419

     Strain or plasmid

     Relevant characteristic(s)

     Reference or source

     Strains E. coli MG1655 JM109 JM110 DH5 C. glutamicum R CRX1 CRX2 CRX3 Plasmids pTrc99A pCRA801 pCRA802 pCRA1 pCRA810 pCRA811

     Prototroph recA1 endA1 gyrA96 thi hsdR17 (rK mK ) e14 (mcrA) supE44 relA1 (lac-proAB) F traD36 proAB lacIqZ M15 dam dcm supE44 hsdR17 thi leu rpsL1 lacY galK galT ara tonA thr tsx (lac-proAB) F traD36 proAB lacIqZ M15 F 80dlacZ M15 (lacZYA-argF)U169 deoR recA1 endA1 hsdR17 (rK mK ) phoA supE44 thi-1 gyrA96 relA1 Wild Cmr; Cmr; Cmr; type C. glutamicum R (wild type) bearing pCRA810 C. glutamicum R (wild type) bearing pCRA811 xylB::Kmr; C. glutamicum R xylB mutant bearing pCRA810

     ATCC 47076 Takara 39 Takara

     25 This work This work This work

     Apr; E. coli expression vector, source of trc promoter Apr; pTrc99A with a 1.4-kb EcoRI-SmaI PCR fragment containing the E. coli xylA gene Apr; pTrc99A with a 1.6-kb EcoRI-SmaI PCR fragment containing the E. coli xylB gene Cmr; -lac multicloning site; E. coli-Corynebacterium sp. shuttle vector derived from pHSG298 and pBL1 Cmr; pCRA1 with a 1.6-kb BglII-BamHI PCR fragment containing the Ptrc-xylA gene construct Cmr; pCRA810 with a 1.7-kb FbaI-BamHI DNA fragment containing the Ptrc-xylB gene construct

     Pharmacia This work This work 26 This work This work

     cells. This limitation was resolved in this study by constructing a recombinant C. glutamicum strain that is capable of ef?ciently and concomitantly metabolizing both glucose and xylose.

     MATERIALS AND METHODS Bacterial strains, media, cultivation conditions, and plasmids. All bacterial strains and plasmids used in

    this study are listed in Table 1. For genetic manipulations, Escherichia coli strains were grown at 37?ãC in Luria-Bertani medium (39). For aerobic growth conditions, C. glutamicum R and recombinant strains CRX1, CRX2, and CRX3 were precultured at 33?ãC overnight in nutrient-rich medium (A medium) containing (per liter) 2 g urea, 2 g yeast extract, 7 g Casamino Acids, 7 g (NH4)2SO4, 0.5 g KH2PO4, 0.5 g K2HPO4, 0.5 g MgSO4 ?? 7H2O, 6 mg FeSO4 ?? 7H2O, 4.2 mg MnSO4 ?? H2O, 0.2 mg biotin, and 0.2 mg thiamine, supplemented with 4% (wt/vol) glucose (20). Where appropriate, media were supplemented with antibiotics. The ?nal antibiotic concentrations were as follows: for E. coli, 50 g ml 1 of ampicillin and 50 g ml 1 of chloramphenicol, and for C. glutamicum, 5 g ml 1 of chloramphenicol and 50 g ml 1 of kanamycin. To investigate the growth performance of C. glutamicum under aerobic conditions, both the wild-type strain and the recombinant strains CRX1, CRX2, and CRX3 were harvested by centrifugation (5,000 g, 4?ãC, 10 min). Cell pellets were subsequently washed twice with mineral medium (BT medium) containing (per liter) 7 g (NH4)2SO4, 0.5 g KH2PO4, 0.5 g K2HPO4, 0.5 g MgSO4 ?? 7H2O, 6 mg FeSO4 ?? 7H2O, 4.2 mg MnSO4 ?? H2O, 0.2 mg biotin, and 0.2 mg thiamine. After the second wash, cells were resuspended in 100 ml of BT medium containing an appropriate concentration of sugars. The resulting mixture was incubated at 33?ãC with constant agitation (200 rpm) in a 500-ml ?ask. Organic acid production under oxygen deprivation. For organic acid production, both wild-type and recombinant CRX2 cells grown in aerobic-phase cultures were harvested by centrifugation (5,000 g, 4?ãC, 10 min). Cell pellets were subsequently washed twice with mineral medium (BT medium). Following the second wash, cells were resuspended, concentrated to the appropriate cell concentration in 80 ml of BT medium containing 100 mM sodium bicarbonate, and incubated at 33?ãC with constant agitation in a lidded 100-ml medium bottle. Organic acid production was started by adding variable amounts of sugar. The pH was monitored using a pH controller (DT-1023; Biott Co. Ltd., Japan) and maintained at pH 7.5 by appropriately supplementing the medium with 2.5 N ammonia.

     DNA manipulations. Plasmid DNA was isolated either by the alkaline lysis procedure (39) or by using a HiSpeed plasmid Midi kit (QIAGEN) according to the manufacturer??s instructions, modi?ed, when extracting DNA from corynebacteria, by using 4 mg ml 1 lysozyme at 37?ãC for 30 min. Chromosomal DNA was isolated from corynebacteria and E. coli following methods previously described (39), modi?ed by using 4 mg ml 1 lysozyme at 37?ãC for 30 min. Restriction endonucleases were purchased from Takara (Osaka, Japan) and used per the manufacturer??s instructions. PCR was performed using a GeneAmp PCR system (Applied Biosystems, Foster City, CA) in a total volume of 100 l with 50 ng of chromosomal DNA, 0.2 mM deoxynucleoside triphosphates, 2% dimethyl

    sulfoxide in LA Taq polymerase buffer with MgCl2, and 4 U of LA Taq polymerase (Takara) for 30 cycles at temperatures of 94?ãC for denaturation (1 min), 55?ãC for annealing (1 min), and 72?ãC for extension (2 min). Oligonucleotide primers used in this study are listed in Table 2. The resulting PCR fragments were puri?ed with a QIAquick PCR puri?cation kit (QIAGEN). Corynebacteria were transformed by electroporation as previously described (50). Transformation of E. coli was performed by the CaCl2 procedure (39). Construction of recombinant plasmids containing xylose metabolism genes. The 1.4-kb E. coli xylA gene (41) was ampli?ed using E. coli K-12 chromosomal DNA as the template and the oligonucleotide primers primer 1 and primer 2 (Table 2) to generate a DNA fragment with EcoRI and SmaI cohesive ends. The PCR amplicon was subsequently ligated to EcoRI- and SmaI-digested pTrc99A plasmid DNA, yielding plasmid pCRA801 (Table 1). Similarly, the 1.6-kb E. coli xylB gene (29) was ampli?ed by PCR using E. coli K-12 chromosomal DNA as the template and the oligonucleotide primers primer 3 and primer 4 (Table 2). The resulting PCR product, which was designed to have EcoRI and SmaI cohesive ends, was subsequently ligated to EcoRI- and SmaI-digested pTrc99A DNA, yielding pCRA802 (Table 1). Plasmid pCRA801 contains the xylA gene under the control of the trc promoter on a 1.6-kb BglII-BamHI fragment. This fragment was subsequently ampli?ed by PCR using pCRA801 plasmid DNA as the template and the oligonucleotide primers primer 5 and primer 6 (Table 2). The resulting PCR product had BglII and BamHI cohesive ends that were used for its cloning into BglII- and BamHI-digested pCRA1 plasmid DNA, yielding plasmid pCRA810 (Table 1). Similarly, the pCRA802 1.7-kb FbaI-BamHI DNA fragment containing the xylB gene under the control of the trc promoter was ampli?ed by PCR using pCRA802 plasmid DNA as the template and the oligonucleotide primers primer 6 and primer 7 (Table 2). The PCR product was designed to have FbaI and BamHI overhangs that were subsequently used to ligate the amplicon to BamHIcircularized pCRA810 plasmid DNA, yielding plasmid pCRA811 (Table 1). The restriction map of plasmid pCRA811 is given in Fig. 1. C. glutamicum R was

     3420

     KAWAGUCHI ET AL. TABLE 2. Oligonucleotides used in this study

     APPL. ENVIRON. MICROBIOL.

     Oligonucleotide primer

     Target gene or plasmid

     Sequence (5 ?C3 )a

     Cohesive end

     Primer Primer Primer Primer Primer Primer Primer Primer Primer

     a

     1 2 3 4 5 6 7 8 9

     E. coli xylA E. coli xylA E. coli xylB E. coli xylB pTrc99A pTrc99A

pTrc99A Native xylB Native xylB

     CTCTGAATTCACCTGATTATGGAGTTCAAT CTCTCCCGGGCATATCGATCGTTCCTTAAA CTCTGAATTCTTTAAGGAACGATCGATATG CTCTCCCGGGTTCAGAATAAATTCATACTA CTCTAGATCTCCGACATCATAACGGTTCTG CTCTGGATCCCTTCTCTCATCCGCCAAAAC CTCTTGATCACCGACATCATAACGGTTCTG CGCGCAGATCCATGTGATTG

    GGTGCGGTTGATCGACAATA

     EcoRI SmaI EcoRI SmaI BglII BamHI FbaI

     The restriction site overhangs used in the cloning procedure have been underlined.

     transformed by electroporation with either pCRA810 or pCRA811 plasmid DNA. Transformants were selected on the basis of chloramphenicol resistance and subsequently screened for growth on xylose as the sole carbon source. For each plasmid, one of these clones able to metabolize xylose was isolated to purity to yield strains CRX1 and CRX2 (Table 1). Transposon mutagenesis of the native corynebacterial xylB gene. Disruption of the corynebacterial xylB gene was achieved via transposon-mediated mutagenesis by electroporation of released Tn5 transposition complexes (16). EZ::Tn transposon containing the kanamycin resistance gene tpnA was mixed with EZ::Tn transposase to generate the transforming transposome according to the manufacturer??s instructions (Epicentre, Wisconsin). The resulting transposome was mixed with C. glutamicum R cells that were subsequently transiently permeabilized by electroporation. Transposon mutants were recovered on kanamycincontaining agar plates. The presence of the transposome in the DNA fragment coding for the corynebacterial xylulokinase was con?rmed by PCR performed using the oligonucleotide primers primer 8 and primer 9 (Table 2) present in the native xylB gene. Insertional mutagenesis of xylB was also con?rmed by xylulokinase activity measurements. DNA sequencing. All sequencing was performed by the dideoxy chain termination method as previously described (40) with an ABI Prism 3100 genetic analyzer (Applied Biosystems) using a Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems). The nucleotide sequences of both strands were determined. DNA sequence data were analyzed with the Genetyx program (Software Development, Tokyo, Japan). Database searches were performed using the BLAST server of the National Center for Biotechnology Information (http:

    //www.ncbi.nlm.nih.gov). Enzyme assays. Cell extracts obtained from batch experiment samples were used for assaying enzyme activities. Enzyme activities were measured at 340 nm and 30?ãC in a ?nal volume of 1.0 ml by using a Beckman DU800 spectrophotometer (Beckman Coulter, Inc., Fullerton, CA). Cultures were harvested by centrifugation at 5,000 g at 4?ãC for 10 min. Cell pellets were washed once with extraction buffer (100 mM Tris-HCl [pH 7.5], 20 mM KCl, 20 mM MgCl2, 5 mM

     MnSO4, 0.1 mM EDTA, and 2 mM dithiothreitol). The resulting cell

    suspensions were sonicated using an ultrasonic homogenizer (Astrason model XL2020; Misonix) in an ice water bath for three 2-min periods, interrupted by 2-min cooling intervals. Cell debris was removed by centrifugation (20,000 g, 4?ãC, 30 min). The cell lysates thus produced were subsequently used as crude extracts for enzyme assays. One unit of enzyme activity was de?ned as the amount of activity necessary to convert 1 mol of NADH to NAD per min. Protein concentrations were determined using a Bio-Rad protein assay kit. Lactate dehydrogenase (LDH) assays were performed as previously described (4). Xylose isomerase activity was determined based on NADH oxidation by sorbitol dehydrogenase as previously described (14). Xylulokinase assays were performed as reported elsewhere (12). Analytical procedure. Samples were centrifuged (10,000 g, 4?ãC, 10 min), and the resulting supernatants were analyzed for the presence of sugars and organic acids. Organic acid concentrations were determined by high-performance liquid chromatography using an apparatus (8020; Tosoh Corporation, Tokyo, Japan) equipped with an electric conductivity detector and a TSKgel OApak-A column (Tosoh Corporation, Tokyo, Japan) operating at 40?ãC with a 0.75 mM H2SO4 mobile phase at a ?ow rate of 1.0 ml min 1. Sugar concentrations were determined by high-performance liquid chromatography using an apparatus (8020; Tosoh Corporation, Tokyo, Japan) equipped with a refractive index detector and a TSKgel Amide-80 column (Tosoh Corporation, Tokyo, Japan) operating at 85?ãC with an 80% acetonitrile mobile phase at a ?ow rate of 1.0 ml min 1. Cell mass was determined by measuring the absorbance at 610 nm (A610) using a spectrophotometer (DU800; Beckman Coulter, Inc., CA). An A610 of 1 corresponded to 0.39 mg (dry weight) cells ml 1. Nucleotide sequence accession number. The DDBJ/EMBL/GenBank accession number for the corynebacterial xylulokinase gene (xylB) is AB234288.

     RESULTS Xylose metabolism gene in corynebacteria. Most corynebacteria are known not to utilize xylose as a carbon source (7). Unlike in E. coli, which is capable of growth on xylose as a sole carbon source, no xylose isomerase-encoding gene is present in any of the corynebacteria sequenced to date. While corynebacteria are unable to catabolize xylose, analysis of the whole genome sequence of C. glutamicum R (data not shown) revealed one open reading frame, the deduced product of which shows signi?cant homology to xylulokinases (encoded by xylB). A similar xylulokinase is also observed in the genome of C. glutamicum ATCC 13032, though its functionality has not been investigated (23, 37). Likewise, we searched the whole-genome sequences of other corynebacteria, including C. diphtheriae NCTC 13129 (5), C. ef?ciens YS-314 (33), and C. jeikeium K411 (46). While the deduced polypeptide gene encoding xylulokinase in C. glutamicum R shares a high level of homology with the putative xylulokinases of C. glutamicum ATCC

    13032 (99% amino acid identity) and C. diphtheriae NCTC 13129 (28% identity), C. ef?ciens YS-314 and C. jeikeium K411 do not possess this gene. These observations thus support the view

     FIG. 1. Restriction map of plasmid pCRA811. Plasmid pCRA811 contains the E. coli-derived xylA and xylB genes cloned in opposite orientations on an EcoRI promoterless cassette. The strong constitutive promoter Ptrc enables constitutive expression of the two xylose utilization genes, thus circumventing the effect of potential transcriptional regulators. The corynebacterial replication origin is from the rolling circle plasmid pBL1.

     VOL. 72, 2006

     XYLOSE METABOLISM IN CORYNEBACTERIA

     3421

     FIG. 2. Comparative aerobic growth of C. glutamicum strains in mineral medium containing either glucose (open symbols) or xylose (?lled symbols). Wild-type C. glutamicum ( and ?ö) and recombinant strains CRX1 (? and ?), CRX2 (E and F), and CRX3 ( and }) were ?rst grown aerobically to late log phase in A medium (containing 40 g liter 1 glucose). These precultures were used to inoculate to an initial A610 of 0.2 mineral medium containing either 111 mM (20 g liter 1) of glucose or 133 mM (20 g liter 1) of xylose as the sole carbon source. The reported data represent the averages calculated from triplicate measurements.

     that a partially functional pathway for xylose metabolism is present in only some corynebacterial species. Construction of a

    xylose-metabolizing strain of C. glutamicum. The presence in the C. glutamicum R genome of a putative xylulokinase suggests that the introduction and expression of a heterologous gene coding for the enzyme xylose isomerase could be suf?cient to enable this strain to convert xylose to common intermediates of the pentose phosphate pathway and thus to grow on media containing xylose as a sole carbon source. However, the possibility that a more ef?cient xylose-utilizing strain could be generated by the concomitant expression of both xylA (xylose isomerase) and xylB (xylulokinase) genes could not be ruled out. In order to clarify the functionality of this putative xylulokinase and to develop an engineered C. glutamicum strain that is capable of ef?cient xylose metabolism, two recombinant strains were constructed by cloning the E. coli xylA gene either alone or in combination with E. coli xylB. To construct these C. glutamicum recombinants, the E. coli xylA and xylB genes were isolated by PCR and precisely subcloned under the control of the strong constitutive trc promoter that is present in vector pCRA1 (26). The PCR product of Ptrc-xylA was cloned into plasmid pCRA1, yielding plasmid pCRA810 (Table 1). Similarly, the PCR product of Ptrc-xylB was cloned into plasmid pCRA810, yielding plasmid pCRA811 (Table 1), where the Ptrc-xylA and Ptrc-xylB are present in divergent

    orientations. C. glutamicum R was transformed by electroporation with either pCRA810 or pCRA811 plasmid DNA. Transformants were selected on the basis of chloramphenicol resistance and subsequently screened for growth on xylose as the sole carbon source. For each plasmid, one of the

     clones able to metabolize xylose was isolated to purity to yield strains CRX1 and CRX2 (Table 1). To evaluate the functionality of the native corynebacterial xylB gene, a strain in which the native xylB gene had been disrupted by Tn5 transposon mutagenesis was isolated from a C. glutamicum mutant library constructed in our laboratory (51). Sequencing of the 1,383-bp xylB locus from this mutant con?rmed the insertion of the transposon 658 bp downstream of the start codon. Insertional mutagenesis of xylB was also con?rmed by xylulokinase activity measurements (data not shown). The mutant was subsequently transformed by electroporation with pCRA810 plasmid DNA. Transformants were selected on the basis of chloramphenicol and kanamycin resistance, and a single colony was isolated to purity to yield strain CRX3 (Table 1). Growth performance of recombinant C. glutamicum strains in xylose mineral medium under standard aerobic conditions. To investigate the ef?ciency of xylose utilization by the recombinant strains CRX1, CRX2, and CRX3, wild-type and transformant strains were grown aerobically in mineral medium containing either glucose (2% [wt/vol]) or xylose (2% [wt/vol]) as a sole carbon source. Strains CRX1 and CRX2 were capable of growth on xylose as a sole carbon source but the wild-type strain was not (Fig. 2). In xylose-containing media, strain CRX2 grew faster than strain CRX1, which expresses only the E. coli xylA and the C. glutamicum xylB genes, although the speci?c consumption rates were not signi?cantly different. In contrast, strain CRX3, which harbors only the E. coli xylA gene since the native corynebacterial xylB gene had been inactivated, hardly grew on xylose. All strains grew on glucose at the same rate (speci?c growth rate, 0.28 h 1) but at a much higher rate than on xylose, as exempli?ed by the observation that the speci?c growth rate of strain CRX2 was 1.4-fold higher on glucose than on xylose ( 0.20 h 1). These observations were supported by enzymatic analyses that revealed that xylose isomerase speci?c activity was observed to occur only in the recombinant strains (Table 3). Likewise, high xylulokinase speci?c activity was observed with strain CRX2 whereas little activity was observed with the wildtype strain. It is noteworthy that the xylulokinase activity of the corynebacterial xylB gene is subject to induction in the presence of xylose, as demonstrated by the ninefold-higher expression of this gene when CRX1 cells were grown on xylose as opposed to glucose. This regulation mechanism is masked in

     TABLE 3. Speci?c activities of xylose isomerase and xylulokinase during aerobic growth in recombinant strains of C. glutamicum

     Sp act (U/mg of protein)c Strain Xylose isomerase Xylulokinase

     Wild type CRX1a CRX1 (grown on xylose)b CRX2a

     a

     ND 0.18 0.26 0.35

     0.05 0.05 0.44 12

     a Cells were grown aerobically in mineral medium containing 222 mM (40 g liter 1) of glucose and harvested in mid-log phase at 6 h. b Cells were grown on 267 mM (40 g liter 1) xylose instead of glucose. c The reported data represent the averages calculated from triplicate measurements. ND, no activity detected.

     3422

     KAWAGUCHI ET AL.

     APPL. ENVIRON. MICROBIOL.

     FIG. 3. Comparative aerobic growth of wild-type C. glutamicum (A) and recombinant C. glutamicum CRX2 (B) in glucose and xylose sugar mixture. Glucose (F), xylose (?ö), and cell (?) concentrations are shown. Both strains were ?rst grown aerobically to late log phase in A medium (containing 40 g liter 1 glucose) with 50 g ml 1 of chloramphenicol (except for the wild type) and then inoculated to an initial A610 of 0.2 into mineral medium containing 20 mM (3.6 g liter 1) of glucose and 24 mM (3.6 g liter 1) of xylose. The reported data represent averages calculated from triplicate experiments.

     strain CRX2, where both the E. coli xylA and xylB genes are constitutively overexpressed. All CRX2 cells tested contained plasmid pCRA811 after at least 12 h of cultivation in the absence of selective pressure. Glucose and xylose consumption during growth. To evaluate whether xylose catabolism mediated by the E. coli xylA and xylB gene construct driven by the trc promoter in a native C. glutamicum background is repressed in the presence of glucose, a 100-ml preculture of CRX2 cells was prepared in mineral medium containing 4% (wt/vol) glucose and was used to inoculate 100 ml of mineral medium containing 20 mM (3.6 g liter 1) glucose and 24 mM (3.6 g liter 1) xylose to give a ?nal cell concentration corresponding to an A610 of 0.2. In this medium, wild-type C. glutamicum R cells ceased togrow upon glucose depletion, while xylose was hardly, if at all, metabolized throughout the incubation period (Fig. 3A). In contrast, strain CRX2 cells consumed both sugars completely, although the maximum speci?c glucose consumption rate (2.8 mmol h 1 g 1 [dry weight] cells) was higher than that of xylose (1.5 mmol h 1 g 1 [dry weight] cells) (Fig. 3B). The speci?c growth rate of strain CRX2 was comparable to that of the wild type ( 0.30 h 1). Strain CRX2 grew to high cell densities without any apparent diauxic effect (Fig. 3B), though xylose consumption was apparently facilitated once the glucose pool had been depleted. This sequential metabolic shift from glucose to xylose suggests that, along

Report this document

For any questions or suggestions please email
cust-service@docsford.com