TXT

2005 JB---Induction of rapid detachment in Shewanella oneidensis...

By Phyllis Campbell,2014-08-25 18:39
13 views 0
2005 JB---Induction of rapid detachment in Shewanella oneidensis...

     ??ÎÄÓÉpumame??Ï×

    pdfÎĵµ?ÉÄÜÔÚWAP?Ëä?ÀÀÌåÑé???Ñ????ÒéÄúÓÅÏÈÑ?ÔñTXT???òÏÂÔØÔ?ÎÄ?þµ????ú?é????

     JOURNAL OF BACTERIOLOGY, Feb. 2005, p. 1014?C1021

    0021-9193/05/$08.00 0 doi:10.1128/JB.187.3.1014?C1021.2005 Copyright ? 2005, American Society for Microbiology. All Rights Reserved.

     Vol. 187, No. 3

     Induction of Rapid Detachment in Shewanella oneidensis MR-1 Bio?lms

     Kai M. Thormann,1 Renee M. Saville,1 Soni Shukla,1 and Alfred M. Spormann1,2,3* ?ä

     Departments of Civil and Environmental Engineering,1 Biological Sciences,2 and Geological and Environmental Sciences,3 Stanford University, Stanford, California

     Received 30 June 2004/Accepted 28 October 2004

     Active detachment of cells from microbial bio?lms is a critical yet poorly understood step in bio?lm development. We discovered that detachment of cells from bio?lms of Shewanella oneidensis MR-1 can be induced by arresting the medium ?ow in a hydrodynamic bio?lm system. Induction of detachment was rapid, and substantial bio?lm dispersal started as soon as 5 min after the stop of ?ow. We developed a confocal laser scanning microscopy-based assay to quantify detachment. The extent of biomass loss was found to be dependent on the time interval of ?ow stop and on the thickness of the bio?lm. Up to 80% of the biomass of 16-h-old bio?lms could be induced to detach. High-resolution microscopy studies revealed that detachment was associated with an overall loosening of the bio?lm structure and a release of individual cells or small cell clusters. Swimming motility was not required for detachment. Although the loosening of cells from the bio?lm structure was observed evenly throughout thin bio?lms, the most pronounced detachment in thicker bio?lms occurred in regions exposed to the ?ow of medium, suggesting a metabolic control of detachability. Deconvolution of the factors associated with the stop of medium ?ow revealed that a sudden decrease in oxygen tension is the predominant trigger for initiating detachment of individual cells. In contrast, carbon limitation did not trigger any substantial detachment, suggesting a physiological link between oxygen sensing or metabolism and detachment. In-frame deletions were introduced into genes encoding the known and putative global transcriptional regulators ArcA, CRP, and EtrA (FNR), which respond to changes in oxygen tension in S. oneidensis MR-1. Bio?lms of null mutants in arcA and crp were severely impacted in the stop-of-?ow-induced detachment response, suggesting a role for these genes in regulation of detachment. In contrast, an

    etrA mutant displayed a variable detachment phenotype. From this genetic evidence we conclude that detachment is a biologically controlled process and that a rapid change in oxygen concentration is a critical factor in detachment and, consequently, in dispersal of S. oneidensis cells from bio?lms. Similar mechanisms might also operate in other bacteria. Most microbes in nature are believed to exist in bio?lms that develop on biotic or abiotic surfaces in aqueous environments (9). The decision of an individual cell or a subpopulation of cells to transition between the surface and the planktonic compartment has critical consequences; nutrient availability, protection from predation, and differences in competitive behavior in one or the other compartment strongly determine an organism??s chance for survival. While most bio?lm studies so far have focused on the initial adhesion events (i.e., the transition from the planktonic to the surface compartment), the release or detachment of cells from bio?lms (i.e., the transition from the surface to the planktonic compartment) is less understood. Bio?lm development is generally categorized into several phases: (i) initial attachment of bacteria to the substratum, (ii) irreversible binding and secretion of extracellular polymeric substances (EPS), (iii) bio?lm maturation, and (iv) dispersal. Loss of cells from bio?lms can be observed during all stages of bio?lm formation. Physical forces such as abrasion, erosion, and sloughing have been recognized as signi?cant factors causing cell loss (8, 39). However, widespread acute release of cells cannot be attributed solely to the effect of physical impact or shear stress. In particular, starvation for several hours for nutrients such as carbon and nitrogen has been shown to induce detachment in Pseudomonas spp., Escherichia coli, and Acinetobacter spp. (2, 3, 13, 19, 20, 35, 43).

     * Corresponding author. Mailing address: James H. Clark Center, E250, Stanford University, Stanford, CA 94305-5429. Phone: (650) 723-3668. Fax: (650) 724-4927. E-mail: spormann@stanford.edu. 1014

     Overcoming the adhesion of bio?lm cells to each other and/or to the EPS is obviously critical for the release of cells, and the initial focus of detachment studies has been on factors and enzymes controlling cellular adhesion to EPS. Important EPS components include polymeric saccharides, such as alginate, colanic acid, and cellulose (11, 15, 30, 46). Extracellular DNA was also recently described to represent an important factor in bio?lm formation of Pseudomonas aeruginosa (42). Additionally, surface proteins, such as Ag43 of E. coli (10), as well as cellular appendices, such as curli or pili (16, 29?C31), have been reported to be involved in mediating cell-cell contact. Modi?cation and degradation processes of EPS have been attributed almost exclusively to the activity of exopolysaccharide lyases, enabling cell dispersal (2, 7, 14, 21, 28, 44). In P. aeruginosa, rhamnolipids are

    thought to maintain bio?lm architecture by in?uencing cell-cell interactions and bacterial attachment to surfaces (12). The often long starvation periods reported in bio?lm dissolution studies raise the question as to whether the transition from the surface to the planktonic compartment occurs because of some general loss of cell function under starvation conditions, such as loss of metabolic activity or energy, release of polysaccharide lyases from lysing cells, etc., or because detachment is a biologically controlled process in response to speci?c environmental stimuli. In support of the latter possibility, it was recently reported that carbon starvation induces rapid detachment in Pseudomonas putida bio?lms, and several genes were identi?ed to be required for the process (17). In this study, we examined the detachment of Shewanella

     VOL. 187, 2005

     DETACHMENT IN S. ONEIDENSIS TABLE 1. Bacterial strains and plasmids used in this study

     1015

     Strain or plasmid

     Relevant genotype or description

     Source or reference

     Bacterial strain E. coli DH5 - pir S17-1- pir S. oneidensis MR-1 AS93 AS95 AS124 AS123 AS122 AS127 AS125 AS126 Plasmid pBluescript KS pGP704-Sac28-Km pGP704-Sac28-Km::Farc pGP704-Sac28-Km::Fcrp pGP704-Sac28-Km::Fetr pME6031 pME6031::arcA pME6031::crp pME6031::etrA

     80dlacZ M15 (lacZYA-argF)U196 recA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1/ pir thi pro recA hsdR [RP4-2Tc::Mu-Km::Tn7] pir Tpr Smr Wild type MR-1 tagged with eGFP in a Tn7 construct, Cmr Gmr Plasmid integration mutant of ?hB in AS93, nonmotile, Cmr Gmr Kmr In-frame deletion of arcA in AS93, Cmr Gmr In-frame deletion of crp in AS93, Cmr Gmr In-frame deletion of etrA in As93, Cmr Gmr AS124 harboring pME6031::arcA, Cmr Gmr Tcr AS123 harboring pME6031::crp, Cmr Gmr Tcr AS122 harboring pME6031::etrA, Cmr Gmr Tcr Apr ori ColE1 Kmr mobRP4 ori-R6K sacB, suicide plasmid for in-frame deletions In-frame deletion fragment of arcA in pGP704-Sac28-Km In-frame deletion fragment of crp in pGP704-Sac28-Km In-frame deletion fragment of etrA in pGP704-Sac28-Km repA oriVpVS1 oriVp15A oriT Tcr arcA in pME6031 crp in pME6031 etrA in pME6031

     23a 36a 41a 40 40 This This This This This This

     study study study study study study

     New England Biolabs Chengyen Wu, unpublished data This study This study This study 17a This study This study This study

     oneidensis MR-1 cells from bio?lms. S. oneidensis is an environmentally and geochemically important facultative microorganism

    capable of using a wide range of terminal electron acceptors under anoxic conditions, including Fe(III) and Mn(IV) minerals (26, 27). Bio?lm formation in this organism was recently characterized (40). We show here that S. oneidensis MR-1 cells can be induced to rapidly disperse from bio?lms in response to a sudden downshift in molecular oxygen concentration, and we provide genetic evidence that detachment in response to a speci?c environmental cue is a biologically controlled process.

     MATERIALS AND METHODS Growth conditions and media. S. oneidensis and E. coli strains used in this study (Table 1) were grown in Luria-Bertani (LB) medium at 30 and 37?ãC, respectively; for plates, the medium was solidi?ed using 1.5% (wt/vol) agar. If required, the medium was supplemented with 10 g of gentamicin/ml, 25 g of kanamycin/ml, and/or 20 g of tetracycline/ml. Bio?lms were grown in lactate medium (LM) (40) containing 500 M lactate without antibiotic supplementation as described previously (40). Strain construction in S. oneidensis: deletion and complementation of arcA, crp, and etrA. DNA manipulations were carried out according to standard techniques (34). Enzymes were obtained from New England Biolabs (Beverly, Mass.). Kits for extracting and purifying DNA were obtained from QIAGEN (Valencia, Calif.) and used according to the manufacturer??s instructions. Mutations in the genome of S. oneidensis were introduced by in-frame deletions leaving only short N- and C-terminal sections of the target genes. For that purpose, 400- to 500-bp upstream and downstream fragments of arcA, crp, and etrA were ampli?ed by PCR with the corresponding primer pairs (-I-fw, -II-fw, -I-rv, and -II-rv) given in Table 2. The fragments were treated with SalI (BamHI for the crp fragment) and ligated; the ligation product was used as template for a second PCR using the outer primers (-I-fw and -II-rv) to yield the truncated gene fusion product. The product was isolated from an agarose gel, digested with SacI and NcoI, and ligated into the suicide vector pGP704-Sac28-Km (C. Wu, unpublished data) treated with the same enzymes. The product was then introduced into the S. oneidensis wild type, strain AS93 (40), by mating using E. coli S17- pir as the donor strain. Single crossover integration mutants were selected on LB plates containing gentamicin and kanamycin. Subsequently, single Kanr and Genr colonies were grown overnight in liquid LB medium without antibiotics

     and then plated on LB containing gentamicin and 8% (wt/vol) sucrose to select for double-crossover events. Finally, kanamycin-sensitive single colonies were subsequently checked for the targeted deletion by colony PCR using primers bracketing the location of the deletion. To complement the mutants, the corresponding genes were ampli?ed from wild-type chromosomal DNA using the outer primer pairs (-I-fw and -II-rv) for arcA and crp and the primer pair etrA-fw and etrA-rv for etrA. For

    arcA and crp, the fragments were treated with NcoI and SacI and ligated into pME6031 treated with the same enzymes. To achieve constant expression of etrA, apparently part of a larger operon with an unknown promoter region, the gene was cloned behind the promoter of the genes encoding the ATPase subunits. The putative ATPase promoter region was ampli?ed with the primer pair P-ATPase-fw and P-ATPase-rv and ligated into the EcoRV restriction site of pBluescript KS (New England Biolabs), and the gene fragment of etrA was inserted by using the EcoRV and PstI sites of the vector. The merged fragments were ?nally released

     TABLE 2. Primers used in this study

     Primer name Sequence (5 3 3 )

     arcA-I-fw arcA-I-rv arcA-II-fw arcA-II-rv arcA-check-fw arcA-check-rv crp-I-fw crp-I-rv crp-II-fw crp-II-rv crp-check-fw crp-check-rv etrA-I-fw etrA-I-rv etrA-II-fw etrA-II-rv etrA-check-fw etrA-check-rv etrA-fw etrA-rv P-ATPase-fw P-ATPase-rv

     CCACGAGCTCTGAGTCATGTTGTCCATCGGTAGTC

    CATTGTCGACAGTTACCACATACCCTTCTGCCTCG

    TACTGTCGACGTGACTATCCGTCGTATCCGTAAGC

    TTGAGGATCCATGGTCTAAGCATTCAATGCGTGG CAACGGCGTTTGATAATGCTGCCAC GCGTTGCAGGACGAAGGCAAGTTG AAACCCATGGGCCTGTATTTCACCTGGTAAC GCATGGATCCAGGTGCTTTTAGCGGGATAC GAAACGGATCCTCATTCAAGCACACGGTAAAAG GTTCGAGCTCCAATTCGGAGACCAGCATGG GCATCACCTTGCTCTGCCTGAACTTG AATCGGCTTCAAGCGCTTTGTCTG ACGCGAGCTCAAGCCATCACCGCTGGATTGATATG TAATGTCGACGAGCTGATCGAGTTCATTAGCATTG

    CATCATCGTCGACCATCATGAACTTAATCTCTTGG

    CTGAGTATCCATGGTGAGTCCTAGGTGATTGTAGG CATCATGATGATCGCGACAG CACCGCTTTTAACTTGTCGTG GGCTGATATCGATTAACTTGAGAACCGACATGAC CATACTGCAGAAAAGGTGTGATTTATCTGGCGAT TAATGTCTGTAGATTAACA

    ATAAATGCGGAGAAGATGAT

     1016

     THORMANN ET AL.

     J. BACTERIOL.

     FIG. 1. Detachment induced by stop of ?ow. The experiment was conducted as a standard stop-of-?ow assay as described in Materials and Methods. Images are shadow projections of 12-h-old CLSM ?les taken of AS93 bio?lms before (A), 10 min after (B), and 30 min after (C) the initial stop of medium ?ow. The scale bar in each image represents 40 m.

     by EcoRI and KpnI and ligated into pME6031 treated with the same enzymes. The resulting plasmids were introduced into the corresponding S. oneidensis mutant by electroporation (24) and selected on LB medium containing gentamicin and tetracycline. Bio?lm cultivation and induced detachment. S. oneidensis bio?lms were grown as described previously (40). All bio?lm characterizations were conducted in triplicate in at

    least two independent experiments. For ?ow-stop experiments, the ?ow was arrested by clamping the in?ow tubing immediately upstream of the ?ow chamber, and the pump tubing was released from the peristaltic pump to avoid a buildup of pressure. To resume the ?ow, the clamp was taken off before the tubing was reinserted into the peristaltic pump. In all experiments, bio?lms in control channels not subjected to a ?ow stop were treated the same as the test bio?lms to ensure that differences in biomass before and after the experiment were not due to bleaching or changes of signal gain. Confocal images were taken immediately prior to clamping the in?ow tubing and 15 min after resuming the ?ow, independent of the ?ow stop duration. For the nutrient downshift experiment, the ?ow was arrested as described above. Prior to connecting the in?ow tubing to the new medium, the medium present in the in?ow reservoir and the bubble trap was replaced in order to avoid a nutrient gradient formation in the bubble trap reservoir. This replacement process took less than 1 min. In control channels, the ?ow was arrested for the same period to exclude detachment due to the stop of ?ow rather than the new medium conditions. The oxygen downshift experiment required a modi?cation in the setup and made use of the rapid diffusion of molecular oxygen through the silicone tubing (S. Kirkelund-Hansen and S. Molin, unpublished data). The in?ow tubing upstream of the ?ow chamber was extended by 2 m and inserted through a rubber septum into a vacuum ?ask. The silicone connection tubing between ?ask and ?ow chamber was replaced by glass tubing, leaving only short joints that allowed handling of the ?ow chamber setup on the microscope stage. A drop in oxygen concentration by diffusion through the silicone tubing walls was then induced by applying vacuum to the ?ask using a Gast G608X vacuum pump (Benton Harbor, Mich.). No ?ow stop was applied during this experiment. Image acquisition. Microscopic visualization of bio?lms was carried out at the Stanford Bio?lm Research Center using an upright LSM510 confocal laser scanning microscope (CLSM; Carl Zeiss, Jena, Germany). The following objectives were used: 10 /0.3 Plan-Neo?uar, 20 /0.5 W Achroplan, and 40 /1.2 W CApochromat. For displaying bio?lm images, CLSM images were processed with the IMARIS software package (Bitplane AG, Zurich, Switzerland) and Adobe ?? Photoshop. Bio?lm parameters, such as biomass, and average bio?lm thickness were quanti?ed with the program COMSTAT (18).

     that arresting the medium ?ow triggered substantial dispersal of the bio?lm. To understand this cell detachment, we developed a quantitative bio?lm detachment assay using CLSM in conjunction with image quanti?cation by COMSTAT (18) (see Materials and Methods). Bio?lms of constitutively gfp-expressing S. oneidensis MR-1 wild-type strain AS93 were grown aerobically for 12 to 14 h on the surface of glass coverslips in ?ow chambers irrigated with LM containing 0.5 mM

    lactate as electron donor as described previously (40). Randomly chosen locations in the bio?lm from the ?rst third of the channel were imaged by CLSM. The ?ow of medium was then arrested, typically for 15 min, and subsequently resumed for 15 min before a second series of CLSM images were taken at exactly the same positions (Fig. 1). The corresponding before-stop-of?ow and after-stop-of-?ow image stacks were quanti?ed for total biomass using the computer program COMSTAT (18) (Fig. 2). The biomass detached was calculated as the difference between the biomass before stop of ?ow minus the biomass after stop of ?ow. Prior control experiments con?rmed that

     RESULTS Stop of ?ow induces detachment of cells from S. oneidensis MR-1 bio?lms. During studies on S. oneidensis MR-1 bio?lms grown hydrodynamically in a ?ow chamber system, we noticed

     FIG. 2. Effect of duration of stop of ?ow on extent of detachment of bio?lms of different thicknesses. The graph represents quanti?ed CLSM images generated by COMSTAT. Detachment assays were conducted as described in Materials and Methods, but the duration of stop of ?ow was varied as indicated by the x axis. ?, 48-h-old bio?lm; ?ö, 18-h-old bio?lm; and }, 12-h-old bio?lm. Each data point is the mean from six independent images taken from two channels. Error bars represent one standard deviation.

     VOL. 187, 2005

     DETACHMENT IN S. ONEIDENSIS

     1017

     FIG. 3. Induction of detachment in 12- and 48-h-old bio?lms. Images display cross sections of stop-of-?ow-induced detachment in 12-h-old (A to C) and 48-h-old (D and E) bio?lms. Images A, B, and C were obtained immediately before, during (15 min), and after the stop of ?ow, respectively; images D and E were obtained before and after the stop of ?ow. Each scale bar represents 25 m in A to C and 50 m in D and E.

     bleaching of the green ?uorescent protein (GFP) ?uorescence was not signi?cant within the parameters used for this assay (data not shown). Loss of biomass was observed and was found to comprise up to 80% of the total biomass for young (e.g., 12-h-old) bio?lms (Fig. 2). Closer examination of the CLSM images as well as time-lapse movies of detachment in 12-h-old bio?lms revealed some characteristic features of the detachment process: rather than large segments of biomass separating from the bio?lm, stop of ?ow resulted in a more or less uniform loosening of the entire bio?lm structure and an even release of individual cells or small aggregates (Fig. 3A to C). This made the bio?lm appear as if it was thinning out. To determine whether bio?lm thickness and the duration of the ?ow stop interval were important parameters for inducing detachment, bio?lms were grown for 12, 18, and 48 h, and the detachment assay was applied with ?ow stop intervals lasting 5, 15, 30, or 60 min

    (Fig. 2). The studies revealed an inverse correlation between the percentage of biomass detached and the thickness of the bio?lm (Fig. 2): the thicker the bio?lm, the smaller the overall degree of cell release. It was further determined that not only the degree of detachment but also the onset of detachment varied with bio?lm thickness (Fig. 2). In 12-h-old bio?lms, up to 80% of the cell mass was detached after 15 min, and extension of the time interval beyond 15 to 30 min resulted in only minor additional biomass loss. In contrast, in 18-h-old bio?lms only about 50% detached under the same conditions (Fig. 2 and 3D and E). The nondetached biomass was found to be viable, and the bio?lms regrew into the S. oneidensis typical architecture (40) when medium ?ow was provided again (data not shown). We hypothesized that this observed differential degree of detachment, or detachability, in the upper layers of older bio?lms could lead to exposure of the nondetached, previously deeper cell layers to higher concentrations of nutrients and oxygen. Consequently, a subsequent increase in metabolic activity might render those cells detachable again. Therefore, we subjected a 20- m-thick bio?lm that did not completely detach after a stop-of-?ow treatment to a second cycle of ?ow stop of 15 min. Between the two stop-of-?ow treatments, the bio?lm

     was exposed to regular medium ?ow for 45 min. After the second stop of ?ow, substantial detachment of former nondetached cells was observed (data not shown). This result implies that detachability can be induced. Nondetached cells are not locked irreversibly in a

    detachment-incompetent state but are capable of reversing to a detachment-competent state, probably by increasing their metabolic activity. Bright-?eld microscopic studies of the detachment process suggested that cell release was not linked to cellular motility, since the majority of the cells detaching from the bio?lm did not show visible swimming motility (data not shown). In order to test whether swimming motility is a crucial prerequisite for detachment, a stop-of-?ow experiment was carried out using S. oneidensis AS95, a nonswimming mutant strain generated by plasmid insertion in ?hB (40). Twelve-hour-old bio?lms of AS95 were very similar to those of the wild type in size and shape (biomass of 12-h-old AS95 bio?lm was 4.45 1.85 m3/ m2, compared to 5.16 1.39 m3/ m2 for the wild type) and were found to lose at least 40% of biomass under ?ow stop conditions (data not shown), indicating that swimming motility is not a critical factor for the observed detachment process. Stop-of-?ow-induced detachment is triggered by a decrease in oxygen concentration. Arresting the ?ow of medium over bio?lms grown in ?ow chambers results in several major changes in the bio?lm environment. First, while the rate of nutrient transfer from the medium drops sharply to 0, the rate of nutrient consumption by the bio?lm cells will continue until the electron donor

    or acceptor becomes limiting, which depends on the medium composition. Such nutrient downshifts have been implicated to lead to detachment in a number of organisms (2, 3, 13, 19, 20, 35, 43). Second, removal of excreted compounds, such as metabolic end products, and/or potential EPS-degrading enzymes and signaling molecules is arrested, which would lead to an accumulation of compounds that could cause the observed bio?lm dispersal. Third, stopping the medium ?ow eliminates the shear stress acting on the bio?lm. In order to identify the trigger(s) for detachment, we modi?ed our assay to uncouple these numerous changes associated with the stop of ?ow. In a ?rst modi?cation, bio?lms were grown in LM as de-

     1018

     THORMANN ET AL.

     J. BACTERIOL.

     FIG. 4. Induction of detachment by nutrient downshifts. The graph (A) represents quanti?ed CLSM images generated by COMSTAT. Modi?ed detachment assays were conducted as described in Materials and Methods. The nutrient downshift was accomplished either by switching to a medium containing buffer only or by removal of oxygen through applying vacuum to the medium in?ow tubing. Each data point is the mean from at least three independent images. Error bars represent one standard deviation. Images B1 and B2 are bio?lm cross sections 45 and 90 min after oxygen downshift, respectively. Each scale bar represents 25 m.

     scribed previously; however, rather than stopping the ?ow, the composition of the medium was changed by switching to a medium without a usable electron donor. This switch required an interruption of ?ow of less than 1 min, which did not induce any signi?cant detachment (Fig. 2). The substituting medium solution contained only the medium??s buffer base (HEPES and NaHCO3), which was previously determined not to support cell growth. After more than 1 h of irrigation with a medium devoid of any usable carbon source, more than 90% of the biomass was still attached (Fig. 4A). This observation demonstrates that a downshift in electron donor concentration can be ruled out as the dominant signal for the stop-of-?ow-induced detachment. We then examined the depletion of molecular oxygen as an inducer of detachment in the bio?lm. As the silicone tubing used for medium intake is permeable to molecular oxygen, we made use of this diffusion property and inserted the in?ow tubing upstream of the ?ow chamber into a ?ask to which vacuum could be applied. After allowing the bio?lm to develop for 12 to 16 h under regular conditions, oxygen removal from the in?owing LM medium was initiated by applying vacuum to the ?ask. This procedure did not require any stop of ?ow and did not result in a signi?cant pH change ( 0.15). As shown in Fig. 4, the downshift in oxygen resulted in a loss of biomass. Signi?cant dispersal of cells began approximately 45 min

    after application of the vacuum, and cell loss leveled off after approximately 75 min. After 2 h, about 50% of the biomass had detached, and the appearance of the depleted bio?lm strongly resembled that observed in the stop-of-?ow experiments (Fig. 3A to C and 4). Therefore, we concluded that a decrease in molecular oxygen concentration is the major trigger for the observed biomass detachment from S. oneidensis bio?lms. Since this set of experiments was conducted without ever arresting the ?ow, it was also concluded that the accumulation of

     extracellular compound(s) during stop of ?ow is not required to induce detachment. As a rapid decrease in oxygen concentration was identi?ed in this respiring microorganism as the major factor inducing detachment, we wondered whether the presence of an anaerobic electron acceptor, such as fumarate, would attenuate the detachment response. Fumarate is readily used by S. oneidensis as an electron acceptor with lactate as an electron donor under anaerobic conditions (25). The detachment experiment was repeated with standard LM that was amended with 2.5 mM fumarate. The detachment response of S. oneidensis MR-1 to the ?ow stop under these conditions was found to be unaltered compared to standard detachment conditions. (data not shown). ArcA, CRP, and EtrA (FNR) are potential regulators of oxygen-dependent detachment. Since a rapid decrease in oxygen concentration was identi?ed as the main trigger for detachment, we examined whether regulators known in other gammaproteobacteria to mediate cellular responses to changing oxygen tension might also be involved in the detachment response. EtrA, the homolog of the E. coli fumarate-nitrate reduction regulator FNR, and CRP have been shown to be involved in regulation of the shift between aerobic and anaerobic metabolism in S. oneidensis MR-1 (32, 33). ArcA, a response regulator, is the analog of the aerobic respiration control protein of E. coli (4). We constructed in-frame deletions of arcA (strain AS124), crp (strain AS123), and etrA (strain AS122) and tested these strains for bio?lm growth and detachability. Twelve- and

    sixteen-hour-old bio?lms of the mutants AS123 and AS122 were grown and subjected to the standard 15-minute ?ow stop experiment. Since the mutation arcA resulted in a growth phenotype, bio?lms of AS124 were allowed to grow for 24 to 28 h to reach a corresponding thickness before being subjected to

     VOL. 187, 2005

     DETACHMENT IN S. ONEIDENSIS

     1019

     FIG. 5. Induced detachment in bio?lms of strains with in-frame deletions in crp, arcA, and etrA. The graph represents quanti?ed CLSM images generated by COMSTAT. Detachment assays were conducted as described in Materials and Methods on bio?lms of strains with either null mutations (AS122, AS123, and AS124) or null mutations complemented

Report this document

For any questions or suggestions please email
cust-service@docsford.com