DOC

Dual Real-time PCR Detection of methicillin-resistant Staphylococcus aureus_3012

By Brittany Hughes,2014-10-30 15:39
8 views 0
Dual Real-time PCR Detection of methicillin-resistant Staphylococcus aureus_3012

Dual Real-time PCR Detection of methicillin-resistant

    Staphylococcus aureus

     Abstract Objective To establish the two heavy real-time

    polymerase chain reaction (duplex real time PCR) Rapid

    detection of methicillin-resistant Staphylococcus aureus

    (MRSA). Methods The two re-SYBR Green real-time PCR for rapid

    detection of MRSA determining gene mecA and Staphylococcus aureus species-specific gene nuc, identified by melting curve analysis product. The results of the melting curve of all MRSA

    strains showed a mecA, nuc gene-specific peaks, methicillin-

    sensitive Staphylococcus aureus only nuc-feng, methicillin-

    resistant strains of the table Portuguese only mecA-feng,

    methicillin-sensitive tables Portuguese bacteria and other bacteria strains non-specific peaks; when the MRSA bacteria can be detected when the concentration of 102cfu/ml. In the 131 S. aureus in 30.53% (40/131) resistance; two heavy real-

    time PCR amplification of mecA gene 29.01% (38/131) positive, nuc gene 100% positive. Single primer and two heavy real-time

    PCR amplification of both the positive coincidence rate of 100%. Conclusion mecA, nuc genes of two re-real-time PCR can

    accurately and quickly identify methicillin-resistant

    Staphylococcus aureus and coagulase-negative staphylococci.

     Key words real-time polymerase chain reaction of methicillin-

    resistant Staphylococcus aureus mecA gene nuc gene

     Rapid detection of methicillin resistant

    Staphylococcus aureus

     ABSTRACT Objective To establish a duplex real time

    polymerase chain reaction (PCR) assay for rapid detection of methicillin resistant Staphylococcus aureus (MRSA). Method A duplex SYBR Green real time PCR assay targeting the mecA

gene and a Staphylococcus aureus specific marker nuc gene

    and identifying PCR products through melting curve analysis was used to rapidly identify MRSA. Results All MRSA strains tested in the study presented mecA and nuc gene specific peaks in the melting curve analysis; methicillin susceptible

    Staphylococcus aureus (MSSA) strains only had a nuc peak, methicillin resistant Staphylococcus epidermidis (MRSE) strains only had a mecA peak, and methicillin susceptible

    Staphylococcus epidermidis (MSSE) strains and strains of species other than staphylococci had no peak. MRSA strains could be detected, by use of this duplex real time PCR in

    an 102 cfu / ml inoculum. Positive rate of drug sensitivity

    test was 30.53% (40/131) among 131 S.aureus isolates tested, of which 29.01% (38/131) were positive for mecA gene and all were positive for nuc gene in the duplex real time PCR. The

    agreement between simplex and duplex real time PCR was 100%

    for positive results. Conclusion This study shows that the duplex real time PCR assay with the primers for to mecA and nuc genes is a valuable tool for rapid and precise identification of MRSA and methicillin resistant coagulase

     negative staphylococci (MRCNS).

     KEY WORDS Real time polymerase chain reaction (RT

    PCR); Methicillin resistant Staphylococcus aureus (MRSA); mecA gene; nuc gene Received Date: 2006 06 15 Revised:

    2006 10 30

     Staphylococcus aureus is caused by hospitals and community-acquired infections important human pathogen, in integration of staphylococcal cassette chromosome mec element (staphylococcal cassette chromosome mec element, SCCmec) and underwent several mutations evolved into methicillin-resistant

    Staphylococcus Portugal bacteria (methicillin resistant

    Staphylococcusaureus, MRSA), vancomycin, including lead, including almost all of the failure of antibiotic treatment [1]. Therefore, rapid and accurate identification of MRSA is a prerequisite for control of nosocomial infections.

     MRSA methicillin-resistant mechanism is mainly by the penicillin-binding protein PBP2a-mediated, SCCmec in the mecA

    gene is the gene encoding PBP2a [2]. Staphylococcus aureus extracellular heat-stable nuclease nuc gene sequences species-

    specific [3]. We use double fluorescent real-time polymerase

    chain reaction (real time polymerase chain reaction)

    testing of clinical isolates of Staphylococcus aureus nuc gene and mecA gene, during the same time, rapid identification of bacteria confirmed MRSA.

     1 Materials and methods

     1.1 Materials

     (1) The strain of origin in September 2005 from 35 hospitals in Anhui Province in the non-duplicate clinical

    specimens isolated 131 Staphylococcus aureus and coagulase-

    negative 6 tables Portuguese bacteria; standard strains

    Staphylococcus aureus ATCC33591 (MRSA) and staphylococcus aureus strain ATCC29213 (MSSA), and Escherichia coli ATCC25922, Klebsiella pneumoniae ATCC700603, such as Pseudomonas aeruginosa ATCC27853 by the Anhui Medical University Affiliated Hospital of Infectious Diseases Section.

     (2) The main reagent SYBR Premix Ex TaqTM (Perfect Real Time) were purchased from TaKaRa Company, is a two-fold

    concentration of premixed reagents (including Hot Start DNA polymerase TaKaRa Ex Taq HS, reaction with buffer, dNTP, SYBR

    Green I, etc.) and with the reference dye ROX Reference Dye II (50 ×); Mueller Hinton agar (Oxoid British company);

    cefoxitin sodium (Haikou, Hainan Hai pharmaceutical drug companies).

     (3) The main instrument ABI Prism 7500 fluorescent

    quantitative PCR instrument (Applied Biosystems Inc. USA), multi-point vaccination instrument (UK AQS Manufacturing Company).

     (4) Real-time PCR primers nuc gene primers NUC1/NUC2, mecA gene of MRSA were amplified by primers MECA1/MECA2 of 279

    and 222bp fragments [3 ~ 5]. Two kinds of primer pairs were commissioned by TaKaRa Corporation synthesis (Table 1).

     1.2 Methods

     (1) Preparation of bacterial cultures with the template, after the recovery of experimental strains were crossed to the

    MH agar plate inoculated, 35 ? cultured 24h, picked a single

    colony dissolved in 100μl sterile distilled water. Bacterial suspension 95 ? water bath, 15min, 7000r/min centrifugal

1min, discard precipitate, leaving the supernatant as the PCR

    reaction of DNA template.

     Table 1 nuc, mecA double real-time PCR primers

     No. GenBank sequence primer (5 '? 3') Tm (?)

    NUC1V01281GCGATTGATGGTGATACGGTT55.9 (511 ? 531)

    NUC2V01281AGCCAAGCCTTGACGAACTAA 60.4 AGC (766 ? 789)

    MECA1X52593GCAATCGCTAAAGAACTAAG51.3 (693 ? 712)

    MECA2X52593GGGACCAACATAACCTAATA51.3 (895 ? 914)

     (2) nuc or mecA gene single-primer real-time PCR 25μl of

    the reaction system contains 12.5μl of SYBR Premix Ex TaqTM (2 ×), 0.5μl of ROX Reference Dye II (50 ×), 2μl of DNA

    template, the upstream and downstream of each primer, 0.2μmol

    / L. In the ABI Prism 7500 PCR instrument on after 95 ?, 10s

    pre-denaturation of the template, and then to 40 cycles of PCR amplification that is 95 ? denaturation 5s, 60 ? annealing

    and extension 34s. The last cycle of melting procedure: 95 ?,

    15s; 58 ?, 1min; 95 ?, 15s. In addition to the temperature change rate rose from 58 ? to 95 ? this step, 0.1 ? / s,

    the rest are 20 ? / s. Fluorescence channel set F1 (530nm) Department, the single-point fluorescence detection at each cycle of 60 ?, 34s annealing and extension steps.

     (3) nuc, mecA gene primers together two real-time PCR

    reaction of total volume of 25μl, including: 2 × SYBR Premix

    Ex TaqTM 12.5μl, 50 × ROX Reference Dye II 0.5μl, DNA

    template 2μl, primers NUC1, NUC2 the 0.2μmol / L, primer

    MECA1, MECA2 the 1.0μmol / L. Single-primer amplification

    procedure and the same real-time PCR. Each test have included the positive control (MRSA standard strain) and negative control (template DNA replaced by sterile water).

     (4) data analysis, after completion of the reaction to confirm SYBR Green I real-time PCR amplification curve and melting curve, combined with CT (threshold cycle, threshold cycle) values, Tm (melting temperature, melting temperature)

    values to determine the result. Samples of bacteria and the expansion of CT values of ? 35 fluorescence curve of

    logarithmic growth; Tm values in the standard MRSA strain Tm (mecA) ? 0.3 ? within the scope of the isolates were considered positive for mecA gene, Tm values in the standard strains of Tm ( nuc) ? 0.5 ? within the scope of the strains

    nuc gene was considered positive. Randomly selected and some of these wild strains of the PCR product was 3% agarose gel electrophoresis.

     (5) The specific test used to detect the two weight-

    specific real-time PCR system mentioned above related to strain.

     (6) The sensitivity of the standard test MRSA bacteria in pure culture by bacteria, will be diluted into the above-

    mentioned by the various 100,10-1,10-2,10-3,10-4,10-5,10-6

    bacilli, and 10 -- seven of eight gradient. Obtained by

    boiling a dilute solution extracted DNA as a template on the fluorescent PCR instrument; an alternative to coating a three flat conducting plate count.

     (7) antibiotic susceptibility testing with the standard quality control strains ATCC29213, according to 2005 American Society of Clinical and Laboratory Standards Institute (CLSI) recommended standard, using agar dilution method for determination of the minimum cefoxitin against Staphylococcus aureus inhibitory concentration (MIC). Results interpretation criteria [6]: cefoxitin MIC ? 8μg/ml as sensitive,

    equivalent to 16μg/ml as an intermediary, ? 32μg/ml for

    drug-resistant.

     2 Results

     2.1 nuc gene, mecA gene detection

     Melting curve analysis showed that all S. aureus nuc gene in a single real-time PCR primers are presented in the Tm values of 80.20 ~ 81.20 ? specificity between the peak; all

    strains with mecA gene mecA gene in a single real-time PCR

    primers are presented in the of the gene-specific peak (Tm

    value, 78.40 ~ 78.90 ?).

     Double SYBR Green real-time PCR-melting curve analysis

    showed that all MRSA isolates were two peaks, one mecA gene-

    specific and the other is specific nuc gene, Tm value range

    with the former; MSSA only one nuc gene specific peak, MRSE appears only mecA gene-specific peak, MSSE there is no

    specific peaks, with the negative control the same results (Figure 1). Several Strains of bacteria in agarose gel

    electrophoresis of PCR products were identified in line with the expected fragment size. Reposted elsewhere in the paper for free download http://

     2.2 The two re-specificity and sensitivity of real-time

    PCR

     Applications NUC1/NUC2, MECA1/MECA2 two pairs of primers

    detecting Escherichia coli ATCC25922, Klebsiella pneumoniae ATCC700603, Pseudomonas aeruginosa ATCC27853, Staphylococcus aureus strains showed no non-specific amplification peak,

    while the positive control appeared in two specific amplification peaks.

     Will be the standard strains of MRSA bacteria suspension preparation of 108,107 ,......, 10cfu/ml concentration of DNA extracted after two re-real-time PCR, melting curve showed

    that, mecA, and nuc genes in bacteria concentration

     2.3 MRSA Identification

     Fluorescent real-time doublePCRRight131The wild strains of Staphylococcus aureus strains of clinical test

    results:nuc,mecAGene pairs positive for theMRSAStrains, onlynucGene positive for theMSSAStrain;mecAGene38Strains positive, the positive rate was29.01%; 100% positive for nuc gene. 6 strains of coagulase-negative strains of wild strains

    of the table Portuguese nuc gene were negative, including five mecA gene single-positive for MRSE, another one pairs negative for the MSSE. nuc / mecA gene single-primer real-time

    fluorescence PCR with the two re-test results were consistent

    with real-time PCR (Table 2).

     Agar dilution method using 131 clinical isolates of Staphylococcus aureus on the cefoxitin resistance, in which resistance 40, intermediary 3, sensitive, 88, drug-resistant

    rate of 30.53% (Table 2).

     Table 2 131 S. aureus two heavy real-time PCR with the

    cefoxitin MIC

     Comparison of (number of trees)

     Cefoxitin MIC (μg / ml) ? 3216 ? 8 Total mecA gene

positive 361,138 Total 40,388,131 negative 428,793

     3 Discussion

     In recent years, MRSA infection rates rising worldwide, and its a multi-drug resistance, making it difficult to

    control the existing antibiotics, hospital infection bacteria. MRSA in a large number of mecA gene expression and β

    lactam antibiotics have a very low affinity PBP2a, to replace the exercise of high-affinity PBPs function is the main

    mechanism of resistance. mecA gene expression of certain

    auxiliary genes and regulatory genes in drug resistance caused by heterogeneity (heterogeneity of resistance). In addition, the moderately resistant Staphylococcus aureus (moderately resistant S.aureus, MODSA), the edge-resistant Staphylococcus

    aureus (borderline oxacillin resistant S.aureus, BORSAs)

    through non-mecA-mediated channels may also show a certain The low level of resistance [7]. Therefore, the need for a comprehensive phenotypic and genotypic identification of both the results of MRSA.

     Agar dilution method is the CLSI / NCCLS recommended by the classical method of detecting MRSA. Cefoxitin-resistant

    Staphylococcus right that all of its β lactam antibiotic

    resistance [8]. We determined cefoxitin against 131 clinical

    isolates of Staphylococcus aureus MIC, resistance rate was 30.53%. MIC method laborious, time-consuming, costly and not

    as a routine method of clinical conduct. At present, mecA gene molecular detection has been replaced by the Act as MRSA identification of the "gold standard" [7].

     Traditional genetic method is based on MRSA target of 2: Staphylococcus aureus species-specific genes and the mecA gene

    encoding PBP2a; combined with the immunological detection of PBP2a be used as a standard MRSA confirmatory test [9].

    However, conventional PCR complicated operation, time-

    consuming, post-operation there is pollution (such as

    electrophoresis, probe hybridization, RFLP, etc. to assess the amplification product). Fluorescent real-time PCR reactions in

    the same sealed tube for amplification and detection, pollution-free, fast, high sensitivity and specificity, is an alternative culture or immunological test for the diagnosis of infectious diseases, one of the best choice [10].

     Foreign reports real-time PCR fluorescent detection of

    MRSA produced chemical used in two ways, one is a sequence non-specific, such as the DNA binding fluorophore SYBR Green [5]; other use of specific fluorescent labeled probes, such as the hybridization pairs of probes [11], nuclease probes [12],

    molecular beacons [13]. In addition to their different mechanisms to generate fluorescence signal, the detection and analysis similar to the basic principle: that repeated cycles of PCR amplification produced a product of exponential manner,

    as well as on the fluorescence intensity of a corresponding increase in fluorescent count monitoring report of the entire fluorescence signal changes by the software analysis results. PCR reaction with the first 3 to 15 cycles of fluorescence signal as a baseline signal, fluorescence signal threshold is defined as the baseline standard deviation of 10 times. PCR products fluorescent signal to reach the threshold set by the amplification cycle when the number of times through the threshold cycle (threshold cycle, CT). The less the amount of DNA template, CT value is greater; if the CT value beyond a certain range, which may produce pollution, observed within the set at 35 cycles. SYBR Green I is a combination of all dsDNA double helix minor groove region, with a green dye

    excitation wavelength. PCR reaction is complete, when the system of uniform temperature from 58 ? up to 95 ?, PCR

    product of a gradual solution of chains, the fluorescence detection of a gradual decline. When the temperature near the Tm value, the double-stranded DNA melting rate of rapid

    change, melting curve will occur at the temperature of a corresponding peak. Tm values of DNA molecules are usually associated with the composition of its sequence, GC content, chain length on the reaction system, the ionic strength, SYBR

    Green I concentration and other factors also affect the value of Tm. According to the amount of melting curve peaks and the degree of stenosis, the corresponding peak temperature Tm is in line with expectations, determine the product specificity.

    In the two re-real-time PCR system, two kinds of end products with different Tm values, analysis of the same reactants fluorescence melting curve can be divided nuc gene (Tm, 80.20 ~ 81.20 ?) and the mecA gene (Tm, 78.40 ~ 78.90 ?). The

    method detection limit of 102cfu/ml, there is no specific cross-reaction tests.

     In this study, 131 clinical strains of S. aureus wild-

    29.01% mecA gene positive, and drug susceptibility method

results (30.53%) approximation. 38 mecA-positive

    Staphylococcus aureus methicillin-resistant Chinese medicine

    Min Act are 36, while an intermediary, a sensitive. The latter two are contained in the mecA gene in a variety of internal and external factors that are potentially under the influence of expression possible, be given to the treatment process should avoid the use of β lactam antibiotics. WU Ben-such

    as the right [14] The study found different temperature, pH, salt concentrations by inducing the expression of drug resistance protein PBP2a significant effect on MRSA to

    oxacillin, cefazolin and ceftazidime resistance level, while its mecA gene is not subject to the conditions of culture the impact of MRSA infection can be quickly detected. mecA gene-

    negative Staphylococcus aureus has four showed resistance, two

    intermediaries, which might be due to β lactamase produced

    a large number of antibiotics and other PBPs with lower affinity. Of these bacteria to high-dose β lactam

    antibiotics or β lactam antibiotics and β lactamase

    inhibitor co-agent is still sensitive, and should avoid the abuse of glycopeptide antibiotics. Zheng Bo, etc. [15] with conventional multi-PCR detection of MRSA and MRCNS, also found through the mecA gene identification method and sensitivity law is not a complete match, but it helps to determine its

    resistance to type, for clinical diagnosis and therapy.

     From the detection of MRSA directly from clinical samples is a topic of concern. As SCCmec elements are widely distributed in the genus Staphylococcus (such as in this trial

    identified five MRSE), so from the direct detection of MRSA in clinical specimens is difficult. Fang et al [5] combination of broth by bacteria and SYBR Green real-time PCR method to

    establish a rapid screening procedure for MRSA in clinical samples, reducing the negative results exclude the time and energy, which is a low MRSA prevalence countries (such as Northern Europe), who is especially meaningful. Real-time PCR

    amplification of MRSA in connection SSCmec and chromosomal insertion sites between the sequences, for direct detection from clinical samples is a promising concept [13]. Of course, this method requires additional confirmation process, and consider the main local epidemic MRSA type, and the new are still unable to identify the type of SSCmec [9].

     Real-time PCR based on the most simple and practical model, we have established low-cost, convenient operation,

accurate and reliable double fluorescent real-time PCR system,

    and is suitable for routine clinical microbiological laboratory suspected staphylococcal isolates Rapid MRSA identification.

     References

     [1] Hiramatsu K, Cui L, Kuroda M, et al. The emergence and evolution of methicillin resistant Staphylococcus aureus

    [J]. Trends Microbiol, 2001,9 (10): 486

     [2] Chambers H F. Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications [J]. Clin Microbiol Rev, 1997,10 (4): 781

     [3] Brakstad OG, Aasbakk K, Maeland J A. Detection of Staphylococcus aureus by polymerase chain reaction

    amplification of the nuc gene [J]. J Clin Microbiol, 1992,30 (7): 1654

     [4] Smyth RW, Kahlmeter G, Olsson Liljequist B, et al.

    Methods for identifying methicillin resistance in Staphylococcus aureus [J]. J Hosp Infect, 2001,48 (2): 103

     [5] Fang H, Hedin G. Rapid screening and identification of methicillin resistant Staphylococcus aureus from clinical samples by selective broth and real time PCR assay [J].

    J Clin Microbiol, 2003,41 (7): 2894 reposted elsewhere free papers on the Download Center http://

Report this document

For any questions or suggestions please email
cust-service@docsford.com