DOC

Disinfectant-resistant Staphylococcus aureus qacA gene research_3013

By Doris Kelly,2014-10-30 15:24
14 views 0
Disinfectant-resistant Staphylococcus aureus qacA gene research_3013

    Disinfectant-resistant Staphylococcus aureus qacA gene research

     Abstract Objective To determine the hospital in recent years, resistance in clinical isolates of Staphylococcus aureus qacA gene level disinfectant for the dynamic monitoring

    of trends in bacterial resistance to antibiotics and effectively control the spread of bacterial resistance to antibiotics provide a solution. Methods in clinical isolates of Staphylococcus aureus our department a total of 252, and confirmed by this laboratory re-appraisal. Reference to the

    United States CLSI / NCCLS standards, with 6μg/ml oxacillin

    and 4% NaCl plate, and selected methicillin-resistant

    Staphylococcus aureus and methicillin-sensitive Staphylococcus

    aureus. Application of PCR gene amplification test for

    detection of qacA disinfectant-resistant Staphylococcus aureus

    in the gene level. Randomly selected from a strain of MRSA-

    positive for gene sequencing, for qacA gene validation. QacA gene-positive strains for MIC testing to see whether there are

    positive strains resistant expression. Results Detection of Staphylococcus aureus 252, of which MRSA 84 strain (with the qacA gene 4), MSSA 168 strains (with qacA gene 1). MRSA-

    positive strains was significantly higher than the MIC disinfectant MSSA strains. Conclusion carry disinfectant resistance gene qacA containing the Staphylococcus aureus is not popular in our hospital.

     Key words Staphylococcus aureus qacA gene disinfectant

     Study on the disinfectant resistant gene qacA in

    Staphylococcus aureus

     ABSTRACT Objective To investigate the disinfectant

    resistant gene qacA in Staphylococcus aureus isolates from the

First Affiliated Hospital of Chongqing Medical University and

    control drug resistance transmission of bacteria. Method Two hundred and fifty two Staphylococcus aureu isolates

    were collected and reconfirmed by our laboratory. The agar plate containing oxacillin 6μg/ml and 4% NaCl was used to

    select methicillin susceptible Staphylococcus aureus and methicillin resistant Staphylococcous aureus, according to the standard recommended by CLSI / NCCLS (2005) of USA. The qacA gene in the isolates were amplified by PCR. The PCR products were sequenced for verification with the object

    sequence of GenBank. The drug susceptible test was

    performed in qacA carrying stains. Results Among 252 Staphylococcous aureus isolates, only 4 strains were found qacA gene in 84 MRSA and 1 strain in 168. The MICs of antiseptics were higher against MRSA than MSSA. Conclusion Disinfectant resistant gene qacA carrying Staphylococcus

    aureus hasn't previled in the hospital.

     KEY WORDS Staphylococcus aureus; Disinfectants; qacA gene

     Staphylococcus aureus (Staphylococcus aureus) is a

    clinical one of the most common pathogens, their toxins and enzymes produced by most Staphylococcus aureus virulence in the strongest, in particular, methicillin-resistant

    Staphylococcus aureus (methicillin resistant Staphylococcus

    aureus, MRSA) is a major pathogen of nosocomial infection, MRSA with multiple drug-resistant feature of the clinical

    anti-infective treatment dilemma. The 20th century, 80 years of foreign academics have in disinfectant-resistant

    Staphylococcus aureus detected genes qacA, 2005, China's

    multi-drug resistant MRSA from disinfectant resistance gene qacA found in the report [1].

     Staphylococcus aureus on the disinfectant resistance gene derived from the name of its quaternary ammonium compounds (quaternary ammonium compounds, qac) resistance, mainly by the qacA, qacB and qacC genes encoding proton-motive force inside

    the bacterial cells depend on the multi-drug efflux system to

    achieve resistance. qacA, qacB and qacC belonging to major facilitator superfamily (majorfacilitator superfamily) and a small family of multi-drug resistance [2]. qacA gene-mediated

    organic cation of the unit (eg, ethidium bromide, benzene, methane, amines and Western music bromide) and divalent organic cations (such as chlorhexidine, pentamidine, etc.)

    disinfectant resistance, qacA gene often is located in a variety of plasmids, including pSK1 family, can also be located on chromosomes. The expression of the protein QacA. QacA on proton-motive force (ie, the formation of the classic michaelis mentan) to achieve the reverse transfer from the bacterial cells inside and outside the exclusive purpose of disinfectants [3,4]. qacB on the low unit price of organic cations and divalent organic cation complex resistance, found in several plasmids, including the heavy metals on the

    resistance plasmid pSK23. qacA, and is highly homologous qacB by gene sequencing found that only 7 bases between the two different expression of only one amino acid difference can not be used PCR and Southern blotting detection methods to

    distinguish, in the nucleotide 323 on, QacA for aspartic acid (Asp), QacB alanine (Ala), but this random or site-directed

    mutagenesis has caused an expression of their resistance to the different [5]. qacC gene was shown to qacD, ebr, and smr

    genes, just different names in different literature, mediated by pairs of quaternary ammonium compounds and ethidium bromide resistance, usually located in clinical isolates of Staphylococcus aureus and other grape The combination of bacteria and non-integrated plasmid [6 ~ 9].

     The main purpose of this experiment is to test in our hospital of 252 clinical isolates of Staphylococcus aureus to

    understand the qacA gene detection level and whether the epidemic in our hospital for the effective control of hospital infections and can cause bacterial resistance to cut off transmission to provide a dynamic observation method.

     An experimental material

     1.1 Sources of bacteria

     The strains used in our hospital in recent years, clinical isolates of Staphylococcus aureus, strains from hospitalized patients sputum, urine, bile, cerebrospinal fluid, and wound, burn wound purulent discharge, each patient during the same period at the same site just take a specimen. Positive strain TS77 from Japan, Tokyo Pharmaceutical University, pathogenic micro-organisms Teaching Professor

    Masahisa Noguchi presented. MIC quality control strains

    Staphylococcus aureus ATCC29213 and Staphylococcus aureus ATCC25923 strain for my library kept by the subjects.

     1.2 Reagents

     (1) PCR Kit (Shanghai Sangon Biological Engineering Technology Service Co., Ltd.), MH agar (Hangzhou Tianhe

    Microbiology Reagent Co., Ltd.), peptone (Japan Pharmaceutical Co., Ltd.), beef extract (Shanghai Biochemical Pharmaceutical Factory Changyang ), EDTA Tris (BBI), NaCl (Beibei, Chongqing Chemical Reagent Factory), Agarose Regular (Bao Bio-

    Engineering Co., Ltd.), oxacillin (content 90.4%, Chongqing Institute for Drug Control provided), acridine yellow (acriflavine, AF), Jie Er-destroy (benzalkoniumchloride, BKC), benzyl chloride Faso (benzethonium chloride, BTC), ethidium bromide (ethidiumbromide, EB), pyronin Y (pyronin Y, PY) from

    the United States Sigma companies.

     (2) DNA Marker DL1200: Beijing days Times Technology Co., Ltd. 1200,900,700,500,300,100 (bp); DL2000: Shanghai Sangon Biological Engineering Technology Services Limited 2000,1000,750,500,250, 100 (bp).

     (3) qacA gene PCR amplification primers (Shanghai Sangon Biological Engineering Technology Services Limited) PUBMED gene pool according to published gene sequences of primers was designed using primer5.0 and reference [1] base sequence as

    follows:

     P1: 5 ' GCTGCATTTATGACAATGTTTG 3',

     1629 1714,629 bp

     P2: 5 ' AATCCCACCTACTAAAGCAG 3',

     2301 2321

     1.3 Main apparatus

     PCR instrument (MJ research PTC 200), nucleic acid

    electrophoresis (CLP), balance (Beijing Medical scale plant), Clean Bench (Su-Net Group Aetna), constant temperature box (Experiment Instrument Factory, Nanjing), gel imaging system (BIORAD), electronic balance (AB104 N), ice-making machine

    (Japan SANYON company), and McNamara turbidimetric tube

    (France Bio Merieux Company), micro-centrifuge (Eppendorf),

    multi-point vaccination instrument (Japan Co., Ltd. Saku Inter-Manufacturing).

     2 Experimental Methods

     2.1 MRSA and MSSA screening

     6μg/ml containing oxacillin and 4% hypertonic NaCl (W / V) of the agar plate were identified [10,11], 35 ? incubated

    24h, there is

Report this document

For any questions or suggestions please email
cust-service@docsford.com