Angiogenesis inhibitor arresten eukaryotic expression system of the establishment of
【Abstract】 Objective To construct the angiogenesis
inhibitor arresten cell clones in eukaryotic expression system. Methods liposome transfection method, through the
eukaryotic expression vector pSecTag2 arresten will
arresten gene into CHO cells by the antibiotic Zeocin selection was positive cell clones, reverse transcription
polymerase chain reaction (RT PCR) detection of arresten
mRNA expression in , Western blot technique (Western blot)
test arresten protein expression. The results obtained after screening positive clones of the CHO cells, RT PCR, Western
blot results suggest that the success of arresten gene into CHO cells and express them. Conclusions obtained stable expression of human arresten factor in CHO cell clones, in order to in-depth study arresten in inhibiting tumor
angiogenesis in the mechanism of action laid a good foundation.
Key words arresten eukaryotic CHO
arresten is the Colorado, etc. [1] discovered a potent angiogenesis inhibitor, it belongs to type ? collagen α1
chain carboxyl-terminal NC1 domain polypeptide fragment and its molecular weight is 26ku, its ability to inhibit angiogenesis and thus inhibit in nude mice transplanted tumor growth. However, the molecular structure of arresten factor characteristics and inhibit tumor angiogenesis and the role of
the specific mechanism is currently poorly understood ways. We use the method of lipofection to arresten gene expression
plasmids into cultured Chinese hamster ovary CHO cell lines, after the screening, and identify its expression in the domestic first obtain a arresten eukaryotic cell clones, In order to study arresten in inhibiting tumor angiogenesis
pathways and specific mechanisms for laying a good foundation.
1 Materials and methods
1.1 Materials
1.1.1 plasmid, the cells of eukaryotic expression plasmid pSecTag2 arresten of this research group to build (another paper), Chinese hamster ovary cell line (CHO) from Tongji Medical College, Huazhong University of Science and Technology Center labs.
1.1.2 Main reagents F12 medium, newborn calf serum, Trizol for Gibco products, one-step RT PCR kit purchased
from Takara Bio Co., Ltd., primer technology companies by the Shanghai Public Health and synthesis, PCR marker for the days of ages. Liposome Lipofectamine 2000, antibiotic Zeocin were purchased from Invitrogen Corporation, anti-human arresten
antibody and two anti-HRP labeled goat anti-rabbit IgG were
purchased from Wuhan Boster Bio-technology companies.
1.2 Methods
1.2.1 eukaryotic expression plasmid pSecTag2 arresten
transfected CHO cells were treated with cationic liposome Lipofectamine 2000 mediated transfection CHO cells. According to the different transfected plasmids, and whether plasmid transfection were divided into three groups: pSecTag2
arresten transfection group; transfected with empty vector pSecTag2 of the negative control group; non-transfected CHO
cells in the control group, transfection method in accordance with Lipofectamine 2000 manual to operate. A simple process is
as follows: 2 d before transfection in order to trypsin digestion and CHO cells were inoculated 24-well plates, each
hole counting cells in the (1 ~ 3) × 105 Ge, to antibiotic-
containing serum-free culture medium of F12 cells was 90% When used in the area of transfection in order to 1μg pSecTag2
arresten dissolved in 50μl medium, 2μl Lipofectamine 2000
dissolved in 50μl medium, incubated for 5 min after mixing 20 min, the slow trickle-down containing 500μl OPTI DMEM
serum-free medium of CHO cells, 6h after culture medium replaced with serum-containing F12 culture medium.
1.2.2 Screening of positive clones after transfection of
the first 24h, the culture plate in the proportion of cells dispersed by 1:10 train, the first 48h after transfection began increasing antibiotic Zeocin screening, screening concentration of 130μg/ml, appeared positive for cloned, 100
μg/ml maintain the filter is about 15d.
1.2.3 reverse transcription-polymerase chain reaction (RT
PCR) detection of the transfected gene mRNA expression in arresten the arresten the basis of known gene sequences, using primer design software Primer5 primers were designed, primers by the Shanghai Public Health Engineering Co., Ltd. Cheng. P1 as upstream primer sequence: GTCAGGATCCTCTGTTGATCACGGCTTC, the downstream primers P2 for GGGCAAGCTTTGTTCTTCTCATACAGAC; within the frame of reference β actin primer sequence β actin
1 for CTCCGCAGGGTGTGATGGTG; upstream and downstream primers β actin 2 to AGAAGGGCGTGCTGAGAAGTTGA. arresten, B
actin amplified fragments were 711bp and 307bp. Using the one-
line RT PCR, the reaction system: Rnase Free H2O 19μl, 5χ
Reaction Buffer 10μl, 2.5mM dNTPs 6μl, 25mM Mn (Oac) 2μl,
P1 2μl, P2 2μl, β actin 1 2μl, β actin 2 2μ
l, 10u/μl Rnase inhibitor, 2μl, 2.5 u / μl rTth DNA
polymerase 2μl, total RNA 2μl. Reaction conditions: 60 ?,
30min; 94 ?, 2min; 94 ?, 10min, 60 ?, 1.5min, 40 cycles;
and finally, 60 ? extension of 7min. Product line of 2%
agarose gel electrophoresis.
1.2.4 Western blot technique (Western blot) protein
expression detected arresten expression product of the SDS
PAGE electrophoresis and Western blotting analysis as a
routine approach. A simple process is as follows: cell lysis with the detergent, SDS PAGE protein electrophoresis,
electric switch to PVDF membrane, plus 30g / L nonfat dry milk closed, PBST wash film, plus rabbit anti-human 1:1 000 anti-
arresten a resistance and incubate 1h at room temperature , PBST washing film; plus goat anti-rabbit secondary antibody
1:10000 HRP marker at room temperature, incubated 1h, PBST wash membrane, mixed chemiluminescence reagent 1 and reagent 2
raised to the membrane 1min, the last X film imaging.
2 Experimental results
2.1 The stable transfection of the positive clone cells were observed under inverted microscope, found that the positive clone cells in cell morphology compared with non-
transfected cells, no significant changes. Reposted elsewhere in the paper for free download http://
2.2 arresten gene RT PCR identification of
electrophoresis results showed that the positive transfected plasmid pSecTag2 arresten appear in clusters of a length of about 711bp specific band, without transfection group and transfection pSecTag2 There were no corresponding bands, the experimental results confirmed that exogenous arresten gene was successfully transfected into CHO cells, shown in Figure 1.
M: marker; 1: transfection pSecTag2 arresten group;
2: transfection pSecTag2 group; 3: non-transfected
control group
Figure 1 transfected gene RT PCR identification of
2.3 Eukaryotic arresten protein expression Western
blot analysis showed that the transfected plasmid pSecTag2
arresten positive group arresten high expression of protein
bands, while the empty vector transfected pSecTag2 and non-
transfected control group arresten protein expression, The experimental results suggest that arresten gene has been obtained in CHO cells, stable expression, shown in Figure 2.
1: transfection pSecTag2 arresten group; 2:
transfection pSecTag2 group;
3: non-transfected control group
Figure 2 arresten protein in CHO cells
3 Discussion
1971, Folkman proposed a "must rely on the growth of
tumor blood vessels," a well-known argument, and gradually
accepted. Since then, the inhibition of angiogenesis is a hot anti-tumor therapy. In recent years, domestic and foreign medical experts found that tumor blood vessel growth and metastasis of tumor cells, the morphological basis of tumor blood vessels provide nutrition addition to tumor cells, but also continue to transfer to humans and other parts of the tumor cells, leading to malignant growth andShift. Therefore, the inhibition of angiogenesis is effective inhibition of
tumor cell growth is also a means of transfer. At present, the study of angiogenesis inhibitors have the following main four kinds of strategies: (1), endothelial cells, blocking the ability to degrade the surrounding matrix; (2) direct
inhibition of endothelial cell function; (3) blocking vascular endothelial growth factor synthesis and release of , antagonism of its role; (4) blocking the surface of endothelial cells in the role of integrins [2]. arresten was discovered in 2000 in Colorado and other angiogenesis
inhibitory factor, the factor can inhibit tumor growth in nude mice. arresten with endostatin from collagen with the angiogenesis inhibitor endostatin endostatin but the same without any toxic side effects, but it also arresten own
merits, it is a stable protein, can effectively to maintain its activity, but because of endostatin protein instability
may limit its use, more importantly, arresten inhibit tumor growth in nude mice were stronger than the effect of endostatin [1]. However, the exact arresten specific ways to inhibit angiogenesis and its associated mechanism is currently not clear, but to obtain the factors are in-depth research
arresten premise.
In our previous studies have in the domestic first obtain a prokaryotic expression of arresten protein [3], although the high yield prokaryotic expression, but the product of the complex nature of poor, low activity, we use the original expression of arresten carried out in the relevant experiments have not been the desired results. The CHO cells are now more commonly used eukaryotic expression system, it can be a long time carried the gene expression without attenuation, and to a large number of stable expression, the expression of proteins produced with glycosylation, phosphorylation and other
modifications, have good biological activity, it is widely used in protein expression and vaccine production. Through liposome transfection methods soon arresten gene into CHO cells by the antibiotic Zeocin screening positive clones
obtained cells, the subsequent RT PCR to confirm that we
successfully arresten gene into CHO cells and detected by Western blot arresten protein expression to the band, the results show that we have successfully arresten successfully integrated into the chromosome of CHO cells, and normal expression of transcription and specific. This shows that we have successfully established a human cell clone arresten eukaryotic expression system. On this basis, we can carry out protein purification and get arresten proteins, for in-depth
study arresten provide the basis for mechanism of action.
In summary, this experiment at home first successful stable transfection arresten eukaryotic CHO cell clones, in order to in-depth study arresten the role of angiogenesis
factor way to lay the foundation and its related mechanisms.
【References】
[1] Colorado PC, Torre A, Kamphaus G, et al. Anti
angiogenic cues from vascular basement membrane collagen \ [J
\]. Cancer Res, 2000, 60 (11): 2520 2526.
[2] Hanahan D, Folkman J. Patterns and emerging mechanisms of
the angiogenic switch during tumorigenesis \ [J \]. Cell,
1996,86 (7): 353 364.
[3] Kwan Kai Cheong, Zheng You-wei, SONG Zi-fang, et al.
Angiogenesis inhibitor arresten gene cloning and expression \
[J \]. Chinese Journal of Biotechnology, 2002,22 (4): 89
92. Reposted elsewhere in the paper for free download Center
http://