DOC

Solid-Phase microextraction for flavor analysis in Harari Khat

By Debra Henry,2014-06-17 09:42
10 views 0
Solid-Phase microextraction for flavor analysis in Harari Khat

    Zong et al. / J Zhejiang Univ Sci B 2009 10(11): 1

    Journal of Zhejiang University SCIENCE B ISSN 1673-1581 (Print); ISSN 1862-1783 (Online) www.zju.edu.cn/jzus; www.springerlink.com E-mail: jzus@zju.edu.cn

    A non-labeled DNA biosensor based on light addressable

    *potentiometric sensor modified with TiO thin film 2

    †‡ Xiao-lin ZONG, Chun-sheng WU, Xiao-ling WU, Yun-feng LU, Ping WANG

    (Biosensor National Special Laboratory, Key Laboratory of Biomedical Engineering of Education Ministry,

    Department of Biomedical Engineering, Zhejiang University, Hangzhou 310027, China)

    E-mail: cnpwang@zju.edu.cn

    Received Mar. 26, 2009; Revision accepted Aug. 8, 2009; Crosschecked Oct. 16, 2009

Abstract: Titanium dioxide (TiO) thin film was deposited on the surface of the light addressable potentiometric sensor (LAPS) 2to modify the sensor surface for the non-labeled detection of DNA molecules. To evaluate the effect of ultraviolet (UV) treatment

    on the silanization level of TiO thin film by 3-aminopropyltriethoxysilane (APTS), fluorescein isothiocyanate (FITC) was used to 2label the amine group on the end of APTS immobilized onto the TiO thin film. We found that, with UV irradiation, the silani-2zation level of the irradiated area of the TiO film was improved compared with the non-irradiated area under well-controlled 2conditions. This result indicates that TiO can act as a coating material on the biosensor surface to improve the effect and effi-2ciency of the covalent immobilization of biomolecules on the sensor surface. The artificially synthesized probe DNA molecules

    were covalently linked onto the surface of TiO film. The hybridization of probe DNA and target DNA was monitored by the 2recording of I-V curves that shift along the voltage axis during the process of reaction. A significant LAPS signals can be detected

    at 10 μmol/L of target DNA sample.

Key words: DNA biosensor, Titanium dioxide (TiO) thin film, Light addressable potentiometric sensor (LAPS), Silanization, 2Fluorescein label, Gene chip

    doi:10.1631/jzus.B0920090 Document code: A CLC number: Q81

INTRODUCTION conventional DNA detection methods employed

     (de-los-Santos-Álvarez et al., 2004).

    To detect the existence or changes of certain Silanization is one of the most frequently em-

    DNA sequences is significant for biological research ployed methods for the surface modification to im-

    and medical diagnosis. Field-effect device (FED) mobilize the biomolecules to the biosensors, the

    sensors for DNA molecule detection have been de-mechanism of which is considered to be the hydroly-

    veloped (Souteyrand et al., 1997; Ingebrandt et al., sis and crosslink of the silane reagent with hydroxyl

    2007; Poghossian et al., 2007; Shishkanova et al., groups on the substrate surface (Silberzan et al.,

    2007). The detection method of the FED sensor de-1991). Several methods have been studied to intro-

    pends on the charge changes before and after the duce the hydroxyl groups or to increase the density of

    hybridization of DNA strands near the sensor surface. these groups on the substrate surfaces. Wet-chemistry

    The application of FED sensor for DNA-hybridization method is frequently employed and reported (Liber-

    detection could omit the need of labels that some tino et al., 2007; Qin et al., 2007), which includes the

    treatment of the surface with strong acids and other

    strong oxidants. The effects of different methods have been compared on glasses (Cras et al., 1999) and Corresponding author *silicons (Han et al., 2006). The wet-chemistry method Project supported by the National Natural Science Foundation of China (Grant Nos. 30627002, 60725102), the Interdisciplinary Re-of surface treatment for silanization should be well search Foundation of Zhejiang University (Grant No. 2009-15)

    Zong et al. / J Zhejiang Univ Sci B 2009 10(11): 2

    controlled to avoid any damages brought to the sur-

    face, especially when the intact surface is important 0.5 mm. Tetrabutylorthotitanate (TBOT) and dimethyl for the readout of the biosensor, such as in the case of sulfoxide (DMSO) were from Beijing Chemicals Co. field-effect devices (Souteyrand et al., 1997). -NH 62Ltd., China. The artificially synthesized probe DNA Titanium dioxide (TiOmodified), complementary target DNA (TCAGGAA ) has been found to have 2(CCAAGAGTTGCAGTTCCTGA, 5-end CCTGCAACTCTTGG), and randomly sequenced the capability to catalyze the oxidization of organic

    DNA (GTGATCGAGTAGGTGAGCTA) were pur-contaminants and exhibit hydrophilicity after ultra-

    chased from Takara Biotechnology Co. Ltd., Dalian, violet (UV) irradiation (Wang et al., 1997; Takeuchi

    China. They were all in phosphate-buffered saline et al., 2005). The UV-induced hydrophilicity of TiO 2(PBS) with desired concentration when samples were surface was attributed to the attachment of more hy-made. Bovine serum albumin (BSA) was provided by droxyl groups onto the surface (Wang et al., 1997; Sino-American Biotechnology Co. Ltd., China. Nakamura et al., 2001); however, its mechanism is 3-Aminopropyltriethoxysilane (APTS), fluorescein still under extensive investigations. isothiocyanate (FITC), and glutaraldehyde were Light addressable potentiometric sensor (LAPS) purchased from Sigma-Aldrich, USA. All reagents is a type of FED, sharing surface photovoltage prop-were of analytical degree and were used without erty with semiconductor, by which the signal of a very further purification. PBS (0.01 mol/L, pH 7.4) and spot on the sensor surface could be read out by fo-carbonate (0.1 mol/L, pH 9.0) buffers were home-cusing a modulated irradiation there. The setup of made. High purity water (Millipore, 18 MΩ?cm) was LAPS is illustrated in Fig.1. After the first report of used to prepare the solutions. this technique by Hafeman et al.(1988), various ap- plications have also been developed (Mourzina et al., Sample preparation 2001; Yoshinobu et al., 2005), including Dill et al. (1) Preparation of LAPS (1997)s and Kung et al.(1990)’s work to detect DNA. LAPS was prepared by extensively cleaning the Here we report a novel approach based on the above Si substrate to remove possible contaminants, fol-mentioned techniques and methods to prepare the lowed by thermal oxidization to grow a 50-nm thick surface of LAPS for the detection of DNA molecules. layer of SiOTiO

     thin film was deposited on the surface of the under 1 180 ?C for 40 min. After the 22LAPS substrate, the artificially synthesized probe deposition of TiO film on the surface, the backside of 2DNA molecules were covalently linked onto the the Si was treated with HF to remove the SiO layer 2surface of silanized TiOand deposited with a layer of aluminium by evapora- film. 2

    tion. Openings of 2 mm in diameter on a mask were

    for ohmic contact and back illumination during

    measurement.

    (2) Preparation of TiO sol-gel and its deposition 2 onto the LAPS surface Sensitive layer Bias voltage TiO film was deposited onto the LAPS surface Depletion layer 2 Silicon substrate by spin-coating of TiO sol-gel. 4 ml TBOT was 2 dissolved in 16 ml ethanol as solution A; 4 ml ethanol, LED A 4 ml water, and 2 ml concentrated nitric acid were mixed together as solution B. Solution B was wa- ter-bathed at 70?C while solution A was added Fig.1 Illustration of the setup of LAPS dropwise with extensive stirring. The solutions were stirred for 3 h after the mixing, and kept sealed under MATERIALS AND METHODS room temperature for 24 h to form TiO sol-gel. 2 The LAPS substrate was spun in the speed of Materials 3000 r/min for 10 s, with 200 µl of TiO sol-gel on the Si for the LAPS preparation was n-type, with a 2

    surface for the spin-coating. After spin-coating, the specific resistance of 3~8 Ω?cm and a thickness of

    substrates were dried in a furnace at 120 ?C for 20 min

    Zong et al. / J Zhejiang Univ Sci B 2009 10(11): 3

    and sintered at 500 ?C for 60 min in air with the

    temperature raised at 10 ?C/min.

     luene and ethanol, the substrates were cured at 120 ?C

    Characterization of TiOfor 1 h. thin film and measure-2

    FITC was dissolved into DMSO (1 mg/ml), and ment of fluorescence

    (1) Wettability property of the TiOthen diluted with carbonate buffer into 0.1 mg/ml surface un-2

    before labeling. Silanized substrates were placed into der UV treatment

    the fluorescein solution under room temperature in The wettability of the TiO surface under UV 2dark for 10 h, and then rinsed completely to remove treatment was observed using a commercial mer-

    any unattached reactants. cury-arc lamp, with filter glass to eliminate the most Measurements of fluorescence were carried out visible and infrared irradiation. The substrate surface

    by the Maestro In-Vivo Imaging System (CRI, USA), was in the dimension of 18 mm×18 mm, covered by a

    with the excitation wavelength at 488 nm and the mask with square openings of 5 mm×5 mm, and in-photographed chip samples in the dimension of 18 tervals of 5 mm between the openings as illustrated in

    mm×18 mm. Fig.2. The TiO-deposited surface was irradiated with -LAPS 22 UV for 2 h in the ambient condition. The measure-DNA probes were immobilized on LAPS by a Preparation of DNA sensor based on TiOment of the contact angles of the seeding layer was covalent crosslink method (Fig.3). The deposited conducted before and after the UV treatment (DSA TiO thin film was silanized by the method as de-210-MK2, Kruss, Germany). scribed above, without the usage of the mask. The

     introduced amine residues reacted with glutaralde-

     hyde overnight under room temperature. After rinsing

     with PBS thoroughly, probe DNA solution was added

     and the amine residues on the end of the probe DNA (d) molecules reacted with the aldehyde residues on the

     TiOfilm under room temperature for 12 h. After the 2 immobilization reaction, the LAPS chip was rinsed (a) again and 1% (v/v) BSA in PBS was added to block any unreacted aldehyde residues and other (b) non-specific binding sites on the TiO film. The 2(c) sensor was rinsed with PBS and kept under 4 ?C be- fore measurement. Fig.2 Diagram of the UV treatment apparatus to the TiO thin film-deposited substrate 2 (a) UV-filter glass; (b) Opaque mask; (c) Si substrate; (d) Probe DNA layer UV light source (2) Silanization and fluorescein labeling of TiOSilanize layer 2 surface under UV treatment The influence of the UV treatment of TiOsur-2 TiOface on the silanization effect of the film was inves- tigated by fluorescein labeling and then measuring the thin film 2 SiO layer 2intensity of the emitted fluorescence. The TiO- 2 Si deposited surface was irradiated with UV for 2 h as described for wettibility test introduced above. The Fig.3 Diagram of the structure of the DNA sensor substrates were kept under ambient environment after based on TiO-LAPS 2UV treatment briefly before silanization. Silanization Measurement setup of DNA sensor based on TiOof the surface was carried out by dipping the sub-- 2strates into the toluene solutions with APTS concen-LAPS tration of 0.1% (v/v) for 1 h and sealed under room The measurement setup is illustrated in Fig.4 and temperature. After being rinsed completely with to-introduced elsewhere (Xu et al., 2005), with a

    Zong et al. / J Zhejiang Univ Sci B 2009 10(11): 4 potentiostat (EG & G M273A Princeton Applied Re-

    search, USA) to supply the bias voltage between the

    LAPS substrate and Ag/AgCl reference electrode, Then 10 μmol/L target DNA sample solution and with a thin Pt wire as counter electrode. The was added to the test chamber to substitute the PBS photocurrent was amplified before entering the solution and the hybridization of DNA was monitored lock-in amplifier (Stanford Research System, SR830, continuously by recording the I-V curves during the USA) for alternating current (AC) signal extraction. reaction process. After the reaction was finished, the The photocurrent was generated by the separation of test chamber was rinsed completely by PBS to make carriers in the space charge region (SCR) of LAPS sure no reactants left and I-V curves were recorded when illuminated from backside by light-emitting again under this solution environment. diode (LED). A wavelength of 830 nm, a power of 70 mW, and an intensity of 10 kHz were used by the oscillator output of the lock-in amplifier. The rec-RESULTS AND DISSCUSION thin film 2orded data were plotted with photocurrent vs. bias Fig.5 shows the photographs of the contact angle voltages, and referred to as I-V curve. Wettability characteristics of TiOmeasurement of the TiOthin film coated on the 2 LAPS substrate surface before and after the UV Lock-in amplifier treatment. The contact angle changed from around RE Inlet 65? to less than 10?, indicating the attainment of the hydrophilicity of the TiO thin film after the UV 2LAPS chip Computer Glass irradiation. EGG LED WE (a) (b) CE Outlet

     Fig.4 Diagram of the measurement setup of the DNA sensor based on TiO-LAPS 2The DNA sensor based on TiO

     -LAPS was 2 sealed as an outer part onto a test chamber, with Fig.5 Contact angle measurement of the TiO thin film 2channels to introduce and expel test samples. The test (a) before and (b) after the UV treatment chamber was put into a faraday cage to avoid any Silanization level of TiOelectromagnetic interference. All measurements were thin film characterized 2conducted in dark and ambient temperature. The by fluorescence measurement control software was homemade using LabView The UV treatment effect on the silanization of (National Instrument Co. Ltd.). TiO thin film was illustrated in Fig.6. The uniformity 2 of the surface could not be guaranteed very definitely Measurement procedure of DNA sensor based on due to the preparation of TiO thin film, so it is more 2TiOexplicit to exam the distribution of the fluorescence -LAPS 2

    intensity with relation to the UV treatment process. PBS (0.01 mol/L, pH 7.4) was first introduced

    The difference of the fluorescence intensity of the into the test chamber and I-V curves were recorded as

    individual UV-treated area was compared with that of blank control. To evaluate the specificity of this

    the non-UV-treated area adjacent to it. The main-DNA detection method, 10 μmol/L randomly se-

    taining period after UV treatment before silanition quenced DNA sample solution in PBS was added to

    process did not affect the appearance of the fluores-the test chamber with DNA sensor based on

    cence emission of the substrate. Fig.6a indicates the TiO-LAPS and underwent the reaction for 12 h 2fluorescence distribution on the substrate maintained under the room temperature. I-V curves were rec-for 20 min in the ambient condition after UV treat-orded. After the process was finished, the test ment and before silanization. It was clear that, under chamber was rinsed again with PBS and I-V curves this situation, the fluorescence intensity was stronger were recorded under this condition.

    Zong et al. / J Zhejiang Univ Sci B 2009 10(11): 5

    600 in the UV-treated areas of the TiO thin film, com-20 h later pared with that in the adjacent areas without any UV 500 1 h later 2 h later treatment. However, with the substrate to which the 400 3 h later 4 h later silanization was carried out right after the UV treat- 300 8 h later 12 h later ment, the pattern of the fluorescence emission on the 200 substrate was quite different, with the intensity much 100 Photocurrent (nA) lower in the UV-treated area than in the non-UV- 0 treated area (Fig.6b). The possible explanation may ?800 ?400 0 400 800 1200 rely on the ability of TiOBias voltage (mV) thin film to produce free 2 radicals after UV irradiation, a mechanism of photo- catalysis to decompose organic materials (Fujishima Fig.7 Measurement characteristics of the DNA sensor based on TiO-LAPS. 10 μmol/L target DNA sample et al., 2000). After UV irradiation ceased, some of the 2was introduced into the test chamber containing DNA produced free radicals may still be active to react with sensor based on TiO-LAPS and I-V was recorded 2 the silanization solution composed of organic com-during the reaction of hybridization ponents, so the rate of silanization process would be slowed down on the UV-treated areas. After the free radicals lost their activities, no decomposing reaction an FED, is considered as the positive site, through will happen in the silanization solution. So the which the work electrode is connected. When the UV-induced hydroxyl groups on the surface of TiO 2voltage between the back and the reference electrode film will exhibit their function, and the extent of si-is positive and increased, the gate is negatively biased lanization increases, which could be presented with if considering the back as 0 potential. Thus, the dep-the increased intensity of fluorescence on the letion layer is enhanced, and the impedance of the UV-treated areas, compared with that of the adjacent substrate is increased. This way the photocurrent will non-UV-treated areas. decrease as the voltage over the substrate increased in

     the positive direction along the axis. The Debye

     length is around 1 nm under the condition of 0.01

     mol/L PBS (Russel et al., 1989). Some of the surface

     charge change can be detected by the LAPS that

     works following the mechanism of FEDs (Poghossian

     et al., 2005).

     The shifts of the I-V curves along the voltage

     axis finally reached a saturation point after 8 h of

     reaction, indicating the completion of the hybridiza-Fig.6 Photographs of fluorescence emission of fluo- tion. The voltage difference measured from the be-rescein-labeled silanized TiO thin films deposited on Si 2 substrate. The substrates were maintained under am-ginning to the end of the reaction was around 100 mV, bient condition for different time after UV treatment consistent with others (Souteyrand et al., 1997). This and before silanization. The white arrows point to the value of voltage shift can be attributed to the positive UV-treated areas. The photographed area is 18 mm×18 modification on the surface of 2 effect of the TiOmm for both samples. (a) 20 min; (b) 0 min LAPS, which will increase the density of the surface Measurement results of DNA hybridization by

    hydroxyl groups after UV treatment for increased DNA sensor based on TiO

    immobilization of the probe DNA. However, it -LAPS 2should be noted that, with the deposition of TiOFig.7 shows the time evolution of the I-V curves on 2

    during the hybridization process. I-V curves move the surface of LAPS, the detection sensitivity would towards more negative voltage as hybridization is in be decreased due to the increase of the thickness of process, because of the negatively charged characte-the insulator layer. This negative effect must be con-ristics of DNA molecules and the n type feature of the sidered and a better detection can be expected. LAPS substrate. Fig.8 illustrates the result of the specificity test

    In our experimental condition, the back of the of this measurement method. Comparing the position LAPS, which is the opposite of the gate in the sense of of the I-V curves along the voltage axis obtained

6 Zong et al. / J Zhejiang Univ Sci B 2009 10(11):

    [doi:10.1016/S0956-5663(99)00043-3] under the same solution environment and measure-14(8-9):683-688. de-los-Santos-Álvarez, P., Lobo-Castañón, M.J., Miranda- ment condition, it is nearly the same before and after Ordieres, A.J., Tuńón-Blanco, P., 2004. Current strategies the randomly sequenced DNA sample was added to for electrochemical detection of DNA with solid elec-the test chamber, revealing a good specificity of this trodes. Anal. Bioanal. Chem., 378(1):104-118. measurement system to the target DNA. [doi:10.1007/s00216-003-2369-0] Dill, K., Chan, S.D.H., Gibbs, T.W., 1997. Detection of plas- mids using DNA and RNA probes and the Before randomly sequenced DNA added light-addressable potentiometric sensor. J. Biochem. Bi-After randomly sequenced DNA added 600 ophys., 35(3):197-202. 500 [doi:10.1016/S0165-022X(97)00038-9] 400 Hafeman, D.G., Parce, J.W., McConnell, H.M., 1988. Light-addressable potentiometric sensor for biochemical 300 systems. Science, 240(4856):1182-1185. 200 Photocurrent (nA) [doi:10.1126/science.3375810] 100 Han, Y., Mayer, D., Offenhäusser, A., Ingebrandt, S., 2006.

     Surface activation of thin silicon oxides by wet cleaning 0 ?800 ?400 0 400 800 1200 and silanization. Thin. Solid Films, 510(1-2):175-180. Bias voltage (mV) [doi:10.1016/j.tsf.2005.11.048] Ingebrandt, S., Han, Y., Nakamuraa, F., Poghossianc, A., Fig.8 Comparison of I-V curves recorded before and Schöningc, M.J., Offenhäussera, A., 2007. Label-free after the randomly sequenced DNA sample was added detection of single nucleotide polymorphisms utilizing to the test chamber with LAPS immobilized with probe the differential transfer function of field-effect transistors. DNA on the surface Biosens. Bioelectron., 22(12):2834-2840. CONCLUSION [doi:10.1016/j.bios.2006.11.019]

     Kung, V.T., Panfili, P.R., Sheldon, E.L., King, R.S., Nagainis,

    P.A., Gomez, B.Jr., Ross, D.A., Briggs, J., Zuk, R.F., We have demonstrated that, with the TiO

    1990. Picogram quantitation of total DNA using thin 2DNA-binding proteins in a silicon sensor-based system. film deposition on the surface of substrates for bio-Anal. Biochem., 187(2):220-227. sensor preparation under well-controlled conditions, [doi:10.1016/0003-2697(90)90447-H] the silanization level increased after UV treatment of Libertino, S., Scandurra, A., Aiello, A., Giannazzo, F., Sinatra,

    F., Renis, M., Fichera, M., 2007. Layer uniformity in the TiO thin film. This increase may be contributed 2glucose oxidase immobilization on SiO surfaces. Appl. 2to the UV-induced hydrophilicity of TiO thin film, 2Surf. Sci., 253(23):9116-9123. which has been proposed to be the increase of hy-[doi:10.1016/j.apsusc.2007.05.039] droxyl group intensity on the surface. When coated Moritz, W., Yoshinobu, T., Finger, F., Krause, S., Mar-

    with the TiOtin-Fernandez, M., Schöning, M.J., 2004. High resolution thin film, the surface of SiO does not 22LAPS using amorphous silicon as the semiconductor need to be treated with strong acids or oxidants to material. Sens. Actuat. B-Chem., 103(1-2):436-441. destroy the organic contaminants and to increase the [doi:10.1016/j.snb.2004.04.073] density of hydroxyl groups on the surface for the Mourzina, Y., Yoshinobu, T., Schubert, J., Lüth, H., Iwasaki, silanization as one way to increase the attachment of H., Schöning, M. J., 2001. Ion-selective light-addressable probe biomolecules for biosensor preparation. This potentiometric sensor (LAPS) with chalcogenide thin simple process will cause little damage to the sensor film prepared by pulsed laser deposition. Sens. Actuat. surface, especially when the field-effect method is B-Chem., 80(2):136-140.

    [doi:10.1016/S0925-4005(01)00906-6] applied. LAPS has the ability to detect the hybridiza-Nakamura, R., Ueda, K., Sato, S., 2001. In situ observation of tion of DNA molecules and the light-addressable the photoenhanced adsorption of water on TiO films by 2characteristics in a time-saving and economic manner, surface-enhanced IR absorption spectroscopy. Langmuir, and may become a potential candidate for a new type 17(8):2298-2300. [doi:10.1021/la0016118] of non-labeled gene chip. Poghossian, A., Cherstvy, A., Ingebrandt, S., Offenhäusser, A., Schöning, M.J., 2005. Possibilities and limitations of la-References bel-free detection of DNA hybridization with field-effect-

    based devices. Sens. Actuat. B-Chem., 111-112: 470-480. Cras, J.J., Rowe-Taitt, C.A., Nivens, D.A., Ligler, F.S., 1999. [doi:10.1016/j.snb.2005.03.083] Comparison of chemical cleaning methods of glass in Poghossian, A., Abouzar, M.H., Amberger, F., Mayer, D., Han, preparation for silanization. Biosens. Bioelectron.,

    Zong et al. / J Zhejiang Univ Sci B 2009 10(11): 7

    Y., Ingebrandt, S., Offenhäusser, A., Schöning, M.J.,

    2007. Field-effect sensors with charged macromolecules:

    characterisation by capacitance-voltage, constant-

    capacitance, impedance spectroscopy and atomic-force

    microscopy methods. Biosens. Bioelectron., 22(9-10):

    2100-2107. [doi:10.1016/j.bios.2006.09.014]

    Qin, M., Hou, S., Wang, L., Feng, X., Wang, R., Yang, Y.,

    Wang, C., Yu, L., Shao, B., Qiao, M., 2007. Two methods

    for glass surface modification and their application in

    protein immobilization. Colloid Surface B, 60(2):243-249.

    [doi:10.1016/j.colsurfb.2007.06.018]

    Russel, W.B., Saville, D.A., Schowalter, W.R., 1989. Col-

    loidal Dispersions, Cambridge University Press.

    Shishkanova, T.V., Volf, R., Krondak, M., Král, V., 2007.

    Functionalization of PVC membrane with ss oligonuc-

    leotides for a potentiometric biosensor. Biosens. Bio-

    electron., 22(11):2712-2717.

    [doi:10.1016/j.bios.2006.11.014]

    Silberzan, P., Leger, L., Ausserre, D., Benattar, J.J., 1991.

    Silanation of silica surfaces. A new method of con-

    structing pure or mixed monolayers. Langmuir, 7(8):

    1647-1651. [doi:10.1021/la00056a017] Souteyrand, E., Cloarec, J.P., Martin, J.R., Wilson, C., Law-

    rence, I., Mikkelsen, S., Lawrence, M.F., 1997. Direct

    detection of the hybridization of synthetic homo-

    oligomer DNA sequences by field effect. J. Phys. Chem.

    B, 101(15):2980-2985. [doi:10.1021/jp963056h] Takeuchi, M., Sakamoto, K., Martra, G., Coluccia, S., Anpo,

    M., 2005. Mechanism of photoinduced superhydrophi-

    licity on the TiO photocatalyst surface. J. Phys. Chem. B, 2109(32):15422-15428. [doi:10.1021/jp058075i] Wang, R., Hashimoto, K., Fujishima, A., Chikuni, M., Kojima,

    E., Kitamura, A., Shimohigoshi, M., Watanabe, T., 1997.

    Light-induced amphiphilic surfaces. Nature, 388(6641):

    431-432.

    Xu, G.X., Ye, X.S., Qin, L.F., Xu, Y., Li, Y., Li, R., Wang, P.,

    2005. Cell-based biosensors based on light-addressable

    potentiometric sensors for single cell monitoring. Biosens.

    Bioelectron., 20(9):1757-1763.

    [doi:10.1016/j.bios.2004.06.037]

    Yoshinobu, T., Iwasaki, H., Ui, Y., Furuichi, K., Ermolenko,

    Y., Mourzina, Y., Wagner, T., Näther, N., Schöning, M.J.,

    2005. The light-addressable potentiometric sensor for

    multi-ion sensing and imaging. Methods, 37(1):94-102.

    [doi:10.1016/j.ymeth.2005.05.020]

Report this document

For any questions or suggestions please email
cust-service@docsford.com